June 2016, Vol.4(3):199–211, doi:10.1016/j.cj.2016.01.004
Open Access, Creative Commons license, Funding information
Title
Ethylene response factor BnERF2-like (ERF2.4) from Brassica napus L. enhances submergence tolerance and alleviates oxidative damage caused by submergence in Arabidopsis thaliana☆
Author
Yanyan Lv a
Sanxiong Fu a
Song Chen a
Wei Zhang a
Cunkou Qi a,b,,
aInstitute of Industrial Crops, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
bJiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing 210095, China
Received 13 October 2015. Revised 14 January 2016. Accepted 2 February 2016. Available online 11 February 2016.
Abstract
Ethylene response factor proteins play an important role in regulating a variety of stress responses in plants, but their exact functions in submergence stress are not well understood. In this study, we isolatedBnERF2.4fromBrassica napusL. to study its function in submergence tolerance. The expression of theBnERF2.4gene inB. napusand the expression of antioxidant enzyme genes in transgenicArabidopsiswere analyzed by quantitative RT-PCR. The expression ofBnERF2.4was induced by submergence inB. napusand the overexpression ofBnERF2.4inArabidopsisincreased the level of tolerance to submergence and oxidative stress. A histochemical method detected lower levels of H2O2, O2•−and malondialdehyde (MDA) in transgenicArabidopsis. Compared to the wild type, transgenic lines also had higher soluble sugar content and higher activity of antioxidant enzymes, which helped to protect plants against the oxidative damage caused by submergence. It was concluded thatBnERF2.4increased the tolerance of plants to submergence stress and may be involved in regulating soluble sugar content and the antioxidant system in defense against submergence stress.
Keywords
Ethylene response factor
Submergence
Oxidative damage
Ectopic expression
Arabidopsis
Antioxidant enzyme
1 Introduction
Biotic and abiotic stresses greatly impair the quality and production of crops worldwide. Excessive water in soil, known as flooding, waterlogging, or submergence, impedes normal crop growth by affecting plant anatomy, morphology, and physiology [1] and [2]. Plants grown in waterlogged fields can suffer hypoxic stress caused by difficulties in oxygen diffusion, leading to a decline in photosynthesis and respiration, degradation of chlorophyll, lipid peroxidation, and malondialdehyde (MDA) accumulation [3]. Ethanol, lactic acid, and other substances generated by anaerobic respiration are harmful to plant growth. Like various stresses that cause oxidative stress due to the production of reactive oxygen species (ROS), a lack of oxygen during waterlogging can also disrupt the balance of ROS generation and scavenging, leading to accumulation of ROS [4] and [5]. Waterlogging affects the levels of endogenous hormones such as ethylene (ET), abscisic acid (ABA), and cytokinin (CTK), disrupting the normal growth and development of plants [6] and [7]. In hypoxic and anoxic environments caused by waterlogging, plants have developed morphological and physiological mechanisms to defend themselves against the stress, such as increasing their soluble sugar content, promoting the activity of fermentative enzymes, and implementing the antioxidant defense system [8]. Many plants, such as Melilotus siculus[9], Oryza sativa[10], and Dendranthema[11], have developed aerenchyma to survive in hypoxic and anoxic conditions.
The ethylene response factor (ERF) family proteins play an important role in regulating a variety of stress responses in plants. The ERF proteins belong to the AP2/ERF superfamily, which is present in all plants as transcription factors. Based on the number and types of AP2/ERF domains, the AP2/ERF superfamily can be divided into AP2, RAV, and ERF families [12]. The ERF family composes of a major portion of AP2/ERF superfamily proteins. Among AP2/ERF proteins, 120 of 148 in soybean (Glycine max L.) [13], 122 of 147 in Arabidopsis, and 139 of 188 in rice (O. sativa L.) belong to the ERF family [14]. The ERF family is divided into two subfamilies, the CBF/DREB and ERF subfamilies. Members of the ERF family participate in the plant's biotic and abiotic stress defense pathway by regulating the expression of downstream genes by binding their promoters with a specific sequence (such as the GCC box) [15].
ERF genes have been identified in some model organisms including rice [16] and [17], Arabidopsis[18], soybean [13], and wheat (Triticum aestivum) [19]. The expression of nine GmERF genes from soybean can be induced by salt, cold, bacterial invasion, drought, and plant hormones. The expression of GmERF3 in tobacco plants enhances resistance to salt, drought, and diseases [13] and [20]. In tomato, the expression of JERF1 can be induced by ABA. In transgenic tobacco, the ectopic expression of JERF1 and JERF3 improves tolerance to osmotic stress, cold, and other stresses. JERF1-regulated gene expression is also involved in the synthesis of proline and ABA [21], [22] and [23]. Overexpression of AtERF98 in Arabidopsisenhances tolerance to salt stress by regulating the synthesis of ascorbic acid in transgenic plants [24]. There have been several reports on the function of ERF in waterlogging stress. Overexpression of Sub1A in rice enhances submergence tolerance [25], [26] and [27]. The Arabidopsis proteins HRE1 and HRE2 also belong to the ERF family. Licausi et al. [28] found that the hre1 and hre2 double mutant was more sensitive to anoxia than the wild type. Overexpression of HRE1 in Arabidopsisimproves anoxia tolerance, with higher activity of pyruvate decarboxylase and alcohol dehydrogenase than in the wild type. However, members of the ERF family regulate gene expression in different ways. By binding to specific promoter sequences (such as the GCC box), AtERF1, AtERF2, and AtERF5 of Arabidopsis activate the expression of downstream genes, whereas AtERF3 and AtERF4 inhibit the expression of downstream genes or the activity of other transcription factors [29].
There have been reports about the role of ERF genes in cold tolerance in B. napus, but only a few ERF genes in oilseed rape have been studied in association with waterlogging stress [30], [31] and [32]. In this report, we isolated and studied the BnERF2.4 gene from B. napus. We found that the expression of the BnERF2.4 gene was induced by submergence. Wild-type Arabidopsis was more sensitive to submergence than BnERF2.4-overexpressing Arabidopsis. Overexpression of BnERF2.4 significantly enhanced submergence tolerance and increased the activity of antioxidant enzymes in transgenic plants. Our study provides further support for the role of BnERF in regulating submergence resistance.
2 Materials and methods
2.1 Plant material and submergence treatments
Seeds of B. napus were germinated at 25 °C. Only germinated seeds were selected and transplanted to pots (height, 8 cm; diameter, 12 cm) containing a 1:1 mix of soil and vermiculite. The plants were grown in a growth chamber at 25 °C (day)/22 °C (night) under a 16-h light/8-h dark photoperiod. For submergence treatments, seedlings at the three-leaf stage were placed into a plastic container (height, 21 cm; diameter, 22 cm) with water covering the top of the seedlings by 2 cm. Nine treatments were designed to study the BnERF2.4 expression pattern in submergence-resistant lines of B. napus: T1, 3 h submergence; T2, 6 h submergence; T3, 12 h submergence; T4, 24 h submergence; T5, 72 h submergence; T6, 72 h submergence + 3 h recovery; T7, 72 h submergence + 6 h recovery; T8, 72 h submergence + 12 h recovery; and T9, 72 h submergence + 24 h recovery. A control was designed for each of the treatments, in which seedlings were cultivated with a normal water supply. All treatments were applied in triplicate. After the treatments, the leaves were immediately frozen in liquid nitrogen for RNA extraction.
Seeds of wild-type and transgenic Arabidopsis (T2 generation) were surface sterilized in 75% ethanol for 1 min followed by 5% NaClO for 5 min. After washing in sterilized water 4 to 6 times, the wild-type seeds were germinated on MS medium and the transgenic seeds were germinated on MS medium containing 50 mg L− 1 kanamycin for selection. Kanamycin-resistant transgenic Arabidopsis were transferred to MS medium to grow for 1 week. Both sets of plants were then transferred to pots containing soil and vermiculite (1:1) and grown at 23 °C (day)/19 °C (night) under a 12-h light/12-h dark photoperiod. After 3 weeks, the following treatments were applied before morphology was recorded: 6 d submergence; 6 d submergence + 1 d recovery; 6 d submergence + 3 d recovery; and 6 d submergence + 6 d recovery; and control. To test antioxidant enzyme activity, H2O2 and O2•− accumulation, contents of chlorophyll, soluble sugar and MDA, the following treatments were conducted: t1, 3 d submergence; t2, 3 d submergence + 1 d recovery; t3, 3 d submergence + 3 d recovery; and control. All treatments were applied in triplicate.
2.2 Isolation of BnERF2.4 and quantitative reverse transcription polymerase chain reaction (RT-PCR)
The open reading frame (ORF) of BnERF2.4 was amplified by polymerase chain reaction (PCR) from its cDNA, using primers P1 and P2 (Table 1). The PCR product was purified from an agarose gel using a gel purification kit (Tiangen, Biotech, China) according to the manufacturer's instructions and then inserted into the pMD18-T vector (Takara, Japan). Successful insertion of BnERF2.4 gene into the pMD18-T vector was confirmed by DNA sequencing.
Table 1. Primers used in the amplification of full-length BnERF2.4 cDNA and for quantitative RT-PCR.
Primer name
Primer sequence (5′–3′)
P1
ATGTACGGACAGAGCGAGG
P2
CACAACCTCGCATTTCACC
P3
TATGTTAGTCTACGGTCTCC
P4
GCTGCCTTCTGTTTCTCCA
P5
CTGGTGATGGTGTGTCTCACAC
P6
GTTGTCTCATGGATTCCAGGAG
P7
GAGTAACTCAGGCAAACCG
P8
GATTTCCTGCCTTGACTAAG
Fe SOD5 (AT5G51100)
TTGGTTCGGGTTGGACAT
Fe SOD3(AT5G51100)
CCATACGAGCGGATTTAC
Cu-Zn SOD 5 (AT2G28190)
CTTCTCATTCCTCCTTCC
Cu-Zn SOD 3 (AT2G28190)
CAACTGTCAACGCTTTCG
AtCAT 5 (AT1G20630)
TGGAGGAGCCAATCACAG
AtCAT 3(AT1G20630)
AGACCAAGCGACCAACAG
POD 5 (AT1G05240)
GATAACAACGCCGCCATT
POD 3(AT1G05240)
ATCATCGCCGCTACAAAA
The expression of BnERF2.4 under submergence stress in the submergence-resistant line of B. napus and its ectopic expression in transgenic Arabidopsis were analyzed by quantitative RT-PCR using the PrimeScript RT reagent kit (Takara, Japan). Primers P3 and P4 were used to amplify BnERF2.4, primers P5 and P6 were used to amplify ACTIN in B. napus, primers P7 and P8 were used for SAND in Arabidopsis as internal controls (Table 1), and primers for antioxidant enzyme genes are also shown in Table 1.
2.3 Transformation of Arabidopsis and selection of transgenic plants
The BnERF2.4 ORF was amplified by PCR using Pfu polymerase and primers P1 and P2 containing restriction sites for Xba I and Sma I. It was then inserted into the plant binary vector pBI121 under the control of the CaMV 35S promoter, producing pBI121-BnERF2.4 (Fig. 1a). Recombinant Agrobacterium tumefaciens (EHA105) clones were selected in YEB medium containing 50 mg/L kanamycin and full-length BnERF2.4cDNA was introduced into Arabidopsis (Columbia) by Agrobacterium-mediated transformation [33].
Fig. 1. The pBI121 vector used to express BnERF2.4 in Arabidopsis (a). Alignment of the deduced amino acid sequence of BnERF2.4 with sequences of other ERFs from Brassica napus and Arabidopsis. The underlined sequence is the AP2/ERF domain (b).
To select for the transgenic Arabidopsis, T1 seeds were sterilized in 75% ethanol for 1 min and 5% NaClO for 5 min and then washed for 4 to 6 times with sterile water. The T1 seeds were germinated on MS medium supplemented with 50 mg L− 1 kanamycin. Leaves from kanamycin-resistant seedlings were collected and RT-PCR was performed to assess the ectopic expression of BnERF2.4 in different transgenic lines, with the wild type as control. ERF-3 and ERF-4 represent two independent BnERF2.4-overexpressing lines. The T2 seeds were harvested for subsequent experiments. GUS staining was performed as described by Jefferson et al. [34] to confirm the insertion of BnERF2.4.
2.4 Assay of chlorophyll, soluble sugar, and MDA content
Chlorophyll solution was extracted from 0.2 g of fresh leaf tissue in 5 mL 95% (v/v) ethanol. Absorbance at 645, 652, and 663 nm was measured using a Shimadzu 2450 UV–visible Spectrometer.
Soluble sugar content was determined by the anthrone method. Dried leaf powder (0.1 g) was added to 10 ml distilled water and the mixture was placed in a water bath at 100 °C for 20 min and then filtered into a 100-ml volumetric flask. The final volume of the reaction mixture was 6 mL, containing 1 mL sugar extract and 5 mL anthrone. The mixture was then boiled for 10 min at 100 °C and the absorbance at 620 nm was measured after it was cooled. A calibration curve constructed with D-glucose was used to determine the soluble sugar content.
MDA content was determined according to Heath and Packer [35]. Fresh leaves (0.2 g) were homogenized in 1.6 mL 10% trichloroacetic acid (TCA), followed by centrifugation at 12,000 × g for 10 min. The supernatant was mixed with an equal volume of 0.67% 2-thiobarbituric acid (TBA), and then boiled at 100 °C for 30 min. Absorbances at 532 nm and 600 nm were measured.
2.5 Histochemical detection of H2O2 and O2•− and assay of antioxidant enzyme activity
Leaf disks were placed in a small beaker. H2O2 and O2•− were detected in the leaves by infiltration of 3,3-diaminobenzidine (DAB) and nitrotetrazolium blue chloride (NBT), respectively, as reported by Romero-Puertas et al. [36]. To detect H2O2, the leaf disks were immersed in 1 mg mL− 1 DAB solution (pH 5.8), vacuum infiltrated for 10 min, and then incubated at room temperature for 24 h without light until the appearance of brown spots. To detect O2•−, the leaf disks were immersed in 0.1% NBT, vacuum-infiltrated for 10 min, and illuminated until the appearance of blue spots. After staining, the leaves were washed in 95% ethanol and images were captured with an OLYMPUS SZX12 stereomicroscope.
Superoxide dismutase (SOD) activity was determined using the method reported by Giannopolitis and Ries [37]. It was determined by its ability to inhibit the formation of nitroblue formazan from NBT. SOD activity was expressed as units (U) mg− 1 FW, the amount required to inhibit the photoreduction of NBT by 50% was defined as one unit of SOD. Each 3 mL reaction mixture contained 50 mmol L− 1 phosphate buffer (pH 7.8), 13 mmol L− 1 methionine (MET), 75 μmol L− 1 nitroblue tetrazolium (NBT), 2 μmol L− 1 riboflavin, 0.1 mmol L− 1 ethylenediaminetetraacetic acid (EDTA), and the appropriate amount of enzyme solution. The absorbance of this mixture was measured at 560 nm after a reaction time of 15 min under illumination (light intensity of 100 μmol m− 2 s− 1).
Catalase (CAT) activity was measured using Aebi's method [38]. Each 3-mL reaction mixture contained 50 mmol L− 1 phosphate buffer (pH 7.0), the appropriate amount of enzyme solution, and 10 mmol L− 1 H2O2. Catalase activity was determined by measuring the change of absorbance at 240 nm. Activity was expressed in μmol min− 1 g− 1 FW.
Peroxidase (POD) activity was determined by measuring the change of absorbance at 470 nm according to Zheng and Van Huystee [39]. Activity was expressed in μmol min− 1 g− 1 FW.
2.6 Statistical analysis
Significant differences among treatments were determined with DPS 9.50 (Data Processing System) [40].
3 Results
3.1 Identification and expression of BnERF2.4 in B. napus
An ORF fragment of 687 bp was obtained by PCR amplification from B. napus cDNA using the conserved AP2/ERF domain sequence. The ORF sequence was identified by BLAST search. It showed high similarity to BnERF2.3.
BnERF2.4 encodes 229 amino acids. It contains a typical AP2/ERF domain, with the 14th and 19th amino acids of the domain being alanine and aspartic acid, respectively, indicating that it belongs to the ERF subfamily. Multiple sequence alignment of the deduced amino acid sequence of BnERF2.4 with other ERF proteins, including BnERF2.3 (FJ788941.1), BnERF50 (HQ613948.1), HRE2 (AT2G47520), and HRE1 (AT1G72360) from B. napus and Arabidopsis, shows the conserved AP2/ERF domain (Fig. 1b).
To study the expression of BnERF2.4 in response to submergence stress, 3-week-old submergence-resistant lines of B. napus were submerged, and BnERF2.4 transcript levels in total RNA extracted from leaves were determined by quantitative RT-PCR (Fig. 2). BnERF2.4 expression began to increase after 3 h of submergence and peaked after 12 h of submergence. The expression level of BnERF2.4 was twice that of the control after 12 h of submergence. After 72 h of submergence, the plants were severely damaged, leading to the decrease of BnERF2.4 expression. However, BnERF2.4 expression increased again once the water was removed. The results indicated that the BnERF2.4-encoded transcription factor was significantly induced in the early stages of submergence.
Fig. 2. Real-time quantitative RT-PCR analysis of ERF2.4 gene expression in submergence-resistant line of B. napus under submergence stress treatments. Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
3.2 Effects of BnERF2.4 on submergence tolerance in transgenic Arabidopsis
Transgenic Arabidopsis plants ectopically overexpressing BnERF2.4 under the control of CaMV 35S promoter, as a GUS fusion, were generated to study the function of BnERF2.4. Transformants were screened by kanamycin selection and PCR amplification with specific primers. The expression of BnERF2.4 in several lines of transgenic Arabidopsis was verified by quantitative RT-PCR (Fig. 3a). T2 seedlings from two individual transgenic lines, ERF-3 and ERF-4, were used in subsequent experiments. Histochemical staining of GUS confirmed transformation of Arabidopsiswith the BnERF2.4 gene. BnERF2.4-GUS activity was detected in the entire seedling of the transgenic Arabidopsis, but not in wild-type seedlings (Fig. 3b).
Fig. 3. Quantitative RT-PCR analysis of BnERF2.4 gene expression in wild-type and transgenic Arabidopsis (a). Identification of transgenic Arabidopsis by GUS staining (b).
There were no differences in shoot growth (Fig. 4a) and root elongation (Fig. 4b) between the wild type and the two transgenic lines under normal water supply conditions. After 6 d of submergence, the leaves of most of the wild-type plants were wilting, and the root elongation was apparently inhibited in wild-type Arabidopsis but not in the transgenic lines. After 6 d of submergence and 6 d of recovery, wild-type Arabidopsis with withered leaves had died, but the transgenic Arabidopsis resumed growth.
Fig. 4. Growth (a) and root length (b) of wild type and transgenic Arabidopsis under submergence treatment. Data represents the means (± SD) of three replicates. Data represent means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
After 3 d of submergence treatment, levels of chlorophyll a and chlorophyll b in both wild-type and transgenic Arabidopsis declined (Table 2). The chlorophyll content began to increase after 3 d of submergence and 3 d of recovery. The chlorophyll contents were significantly higher in ERF-3 and ERF-4 than in the wild type. After 3 d of submergence and 1 d of recovery, the content of chlorophyll a was 0.74 mg g− 1FW in the wild type but 0.92 mg g− 1 FW and 0.84 mg g− 1 FW in the two transgenic lines, respectively. After 3 d of submergence and 3 d of recovery treatment, there was no significant difference in chlorophyll content between wild-type and transgenic plants. The soluble sugar contents of the wild-type and transgenic Arabidopsis lines were also determined. After 3 d of submergence treatment, the soluble sugar content increased significantly in the transgenic lines but not in the wild type. This increase could have been due to improved tolerance of BnERF2.4-overexpressing Arabidopsisto submergence stress. This trend continued throughout the recovery process (Fig. 5).
Table 2. Chlorophyll contents in wild-type and transgenic Arabidopsis under submergence treatments.
Treatments
Chlorophyll a (mg g− 1 FW)
Chlorophyll b (mg g− 1 FW)
Wild type
ERF-3
ERF-4
Wild type
ERF-3
ERF-4
Control
1.05 ± 0.10ab
1.05 ± 0.11a
1.00 ± 0.12abc
0.38 ± 0.03a
0.39 ± 0.02a
0.37 ± 0.04ab
3 d submergence
0.88 ± 0.05de
0.99 ± 0.00abcd
0.89 ± 0.02cde
0.28 ± 0.02d
0.32 ± 0.01bcd
0.30 ± 0.01d
3 d submergence + 1 d recovery
0.74 ± 0.03f
0.92 ± 0.08bcde
0.84 ± 0.04ef
0.29 ± 0.02d
0.34 ± 0.04abc
0.31 ± 0.02cd
3 d submergence + 3 d recovery
0.87 ± 0.07def
0.94 ± 0.06abcde
0.91 ± 0.07cde
0.31 ± 0.02bcd
0.36 ± 0.02abc
0.32 ± 0.02bcd
Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
Fig. 5. Soluble sugar contents in wild-type and transgenic Arabidopsis under submergence treatments. Data represent the means (± SD) of three replicates. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
3.3 Effects of submergence on production of H2O2, O2•−, and MDA in transgenic Arabidopsis
The presence of H2O2 and O2•− in the plants was assessed using DAB and NBT staining, respectively (Fig. 6a and b). Small amounts of H2O2 and O2•− were accumulated in both wild type and transgenic Arabidopsis leaves under normal conditions. However, after 3 d of submergence treatment, H2O2 and O2•− started to accumulate and the amounts of H2O2 and O2•− were higher in wild type plants. After 3 d of submergence and 1 d of recovery treatment, significant amounts of H2O2 and O2•− were produced in both wild-type and transgenic plants, indicating that both had suffered significant oxidative damage. After 3 d of submergence and 3 d of recovery treatment, levels of H2O2 and O2•− continued to rise in the wild-type leaves, but significantly decreased in transgenic lines, showing that the transgenic Arabidopsishad suffered less oxidative damage from submergence.
Fig. 6. Histochemical localization of H2O2 and O2•− by DAB (a) and NBT (b) staining and MDA contents in wild-type and transgenic Arabidopsis under submergence treatments (c). Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
After 3 d of submergence treatment, the MDA level in wild-type Arabidopsisincreased significantly initially, and then decreased during the recovery period. But the MDA level in the transgenic Arabidopsis remained almost unchanged during the whole period (Fig. 6c). This result showed that the wild-type was more susceptible than the transgenic Arabidopsis to oxidative damage caused by submergence stress.
3.4 Effect of submergence treatments on antioxidant enzyme activity and related genes expression in transgenic Arabidopsis
Under submergence stress, plants suffered from oxidative damage, evidenced by the increase of H2O2, O2•− and the MDA accumulation (Fig. 6). The results showed that the oxidative damage caused by submergence was much lower in transgenic than in wild-type Arabidopsis, and the activities of SOD, POD, and CAT in the transgenic Arabidopsis were higher than in the wild type under the treatments (Fig. 7). These results were consistent with the gene expression profile by RT-PCR (Fig. 8). Expressions of Fe-SOD, Cu/Zn-SOD, and POD in transgenic lines were higher than in the wild type, even under control conditions. After 6 h of submergence, the expression of these genes increased in both transgenic and wild-type lines. Transgenic lines also showed higher expression of all of the above antioxidant enzyme genes. Thus, the overexpression of BnERF2.4 could activate the expression of antioxidant enzyme genes and increase antioxidant enzyme activities in transgenic plants, protecting plants from submergence damage.
Fig. 7. Antioxidant enzyme activities in wild-type and transgenic Arabidopsis under submergence treatments. Data represent means (± SD) of three replications. Different characters indicate significant difference between wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
Fig. 8. Real-time quantitative RT-PCR analysis of BnERF, Fe-SOD (AT5G51100), CAT(AT1G20630), Cu–Zn SOD (AT2G28190), and POD (AT1G05240) in wild-type and transgenic Arabidopsis after 6 h submergence treatment. Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
4 Discussion
ERF family is a large family of transcriptional regulators involved in plant growth, development, and defense against biotic and abiotic stresses [12]. ERF family is part of the AP2/ERF superfamily, which also contains the AP2 and RAV families, distinguished on the basis of number and location of AP2/ERF domains [14]. Several ERF genes have been characterized in Arabidopsis[29], rice [14] and [16], wheat [19], and soybean [13]. Several AP2/ERF-family genes in B. napus have been studied [31], [32], [41] and [42]. BnERF2.4 belongs to the ERF subfamily, having a single AP2/ERF domain with conserved Ala14 and Asp19.
ERF proteins participate in the mechanism of resistance to several biotic and abiotic stresses. Their expression can be induced by stresses such as pathogen attack [43], [44] and [45], salt [13], cold, and hormone treatment [32]. Overexpression of GmERF057 and GmERF089 from soybean confers increased tolerance to salt, bacterial pathogen attack, and drought in transgenic tobacco plants [13]. JERF1 from tobacco improved the drought resistance of transgenic rice seedlings [22]. The expression of ERF can also be induced by waterlogging stress or hypoxia. The effects of stress on ERF expression vary among plant species, tissues, and ERFtypes. HRE1 and HRE2 in Arabidopsis play important roles in low-oxygen signaling in plants. Expressions of both HRE1 and HRE2 were induced after 2 h of hypoxia treatment. HRE1 was expressed mainly in the root and HRE2 in both the shoot and the root in Arabidopsis. HRE1-overexpressing Arabidopsis showed improved tolerance of anoxia [28]. OsBIERF1 but not OsBIERF3 and OsBIERF4 transcripts from O. sativa were detected in water-treated rice seedlings [16]. In the present study, several ERF genes (data not shown) were obtained using the conserved AP2/ERF domain sequence. It was found that the expression of BnERF2.4 was induced in the early stages of submergence. Plants submerged for a short period of time reduced respiration and photosynthesis due to shortage of oxygen [4], and they needed to recover when the submergence treatment was stopped. BnERF2.4 was needed to regulate the signaling pathways. It was involved in protecting the plant against submergence stress and aided in the recovery from damage. Thus, the expression of BnERF2.4 increased in the early stages of submergence.
To identify the role of BnERF2.4 in submergence resistance, we investigated the morphological and physiological differences between the wild type and two transgenic Arabidopsis lines, ERF-3 and ERF-4, under different submergence conditions. No morphological differences were observed under normal conditions or 3 d of submergence (data not shown). After 6 d of submergence treatment, the leaves of the wild-type and transgenic Arabidopsis lines became yellow and withered, a result consistent with those of a previous study of waterlogging effects on crops [46]. Under waterlogging conditions, the translocation of nitrogen from older leaves to younger leaves causes chlorosis of older leaves [47]. The same phenomenon was also observed in this study. It was noteworthy that the transgenic lines grew much better than the wild type. After 6 d of submergence and 6 d of recovery treatment, the wild-type plants were almost dead, whereas the transgenic plants were still alive and growing normally, suggesting that they were able to use the BnERF2.4-regulated pathways to recover from the damage.
In fact, the plants suffered more serious damage during the recovery period than in the submergence phase. The production of oxidative molecules is characteristic of hypoxia and especially of reoxygenation [48]. A similar study in B. napus confirmed that physiological functions were retarded during waterlogging, and its adverse effects remained after waterlogging had ceased [49]. Malik et al. [50] found no apparent effects during short-term waterlogging, but observed adverse effects during the recovery phase, with even short-term (as few as 3 d) waterlogging showing clear effects on plant growth. In the present study, we observed no morphological differences after 3 d of submergence, but the physiological effects differed between wild-type and transgenic plants.
Under submergence conditions, leaf chlorophyll decreased significantly in plants [51]and [52]. Waterlogging also resulted in decreased chlorophyll content in both waterlogging-tolerant and -susceptible pigeon pea (Cajanus cajan L.) [53]. In the present study, the chlorophyll content decreased in both wild type and transgenic plants after submergence, but the chlorophyll level was higher in the two transgenic lines than in the wild type. Plants grown in waterlogged fields can suffer hypoxic stress, leading to degradation of chlorophyll [3]. The wild type suffered more from submergence stress, showing yellow and withered leaves, whereas BnERF2.4-overexpressing Arabidopsis lines showed slower chlorophyll degradation. Soluble sugar serves as an energy source and as signaling molecules that can activate transduction pathways [54] and can enhance plant tolerance to multiple stresses. Exogenous sucrose greatly enhanced anoxia tolerance of Arabidopsis seedlings [55]. Waterlogging also caused an increase in reducing sugars in a tolerant line of Vigna radiata[56]. In the present study, an immediate increase in soluble sugar after submergence treatment was observed in transgenic Arabidopsis, in contrast to an initial decrease in wild-type plants. Wild-type and transgenic plants had similar soluble sugar contents after 3 d of submergence and 1 d of recovery. It is likely that the BnERF2.4 overexpression enhanced soluble sugar content, which not only can be used as an energy source, but also is involved in signaling pathways. Soluble sugar can also enhance submergence resistance by adjusting osmotic potential. Zhang et al. [20] reported higher levels of soluble sugars in GmERF3-overexpressing tobacco than in wild-type plants under non-stressed and drought-stress conditions. Similarly, Wu et al. [23] found that the expression levels of osmotic stress genes were higher in JERF3-overexpressing tobacco, including genes involved in sugar synthesis.
Waterlogging disrupts the balance between production and scavenging of ROS and induces oxidative damage in plants [5], [46] and [57]. H2O2 and O2•− levels accumulated in leaves were measured using DAB and NBT staining methods. The leaves of transgenic Arabidopsis accumulated less H2O2 and O2•− than those of the wild type. Transgenic Arabidopsis also had lower MDA content, which was directly linked to ROS accumulation. MDA level is considered to be a measure of lipid peroxidation status and can be used as an indicator of plant oxidative damage [58]and [59]. Plant MDA contents gradually increased with flooding duration [60]. In the present study, during the 3 d submergence treatment, MDA content in wild-type Arabidopsis increased significantly to 1.6 times the control level. However, MDA content in transgenic Arabidopsis did not change over the entire treatment period, indicating that wild-type Arabidopsis suffered greater damage than transgenic plants during the submergence treatment. Zhang et al. [24] reported higher MDA contents in aterf98 mutant than wild-type plants, and ATERF98-overexpressing Arabidopsisaccumulated less MDA than wild-type plants under salt stress conditions. Thus, overexpression of ERF genes in plants may inhibit ROS generation and accumulation pathways, leading to lower MDA contents in plants.
Activation of antioxidant enzymes may provide another method for ERF-overexpressing transgenic plants in their defense against stress. When plants suffer oxidative damage, the antioxidant enzyme system plays an important role in the process of scavenging ROS [53] and [61]. SOD is the first line of antioxidant defense [62]. A short duration of hypoxia enhanced the activities of SOD, CAT, ascorbate peroxidase (APX), and glutathione reductase (GR) in Zea mays leaves [59]. Waterlogging treatment before anthesis was found to increase activities of SOD, APX, and CAT in enhancing tolerance to waterlogging after anthesis in wheat [63]. In the present study, activities of SOD, POD, and CAT increased after submergence in both wild-type and transgenic plants. But the activities of these enzymes were higher in transgenic lines than in the wild type even under normal conditions. Our results also showed a higher expression of antioxidant enzyme genes with the overexpression of BnERF2.4. A similar phenomenon was observed in JERF3-overexpressing tobacco. The expression of JERF3 in tobacco increased the activity of SOD and decreased the accumulation of ROS [23], JERF3 activated the expression of NtSOD by interacting with the GCC box in the NtSOD promoter. Our present study provides new evidence that BnERF2.4 activates the antioxidant system and protects plants from oxidative damage. However, the mechanism by which BnERF2.4 regulates downstream genes is still unknown.
In conclusion, the present study has provided further evidence that BnERF2.4 plays an important role in defense against submergence stress. Regulation of the antioxidant system is probably one of the mechanisms.
Acknowledgments
This work was supported by the Natural Science Foundation of Jiangsu, China(BK2011668), the China Agriculture Research System (CARS-13) and the National Key Technology Research and Development Program of China (2010-BAD01B10).
Molecular characterization of four rice genes encoding ethylene-responsive transcriptional factors and their expressions in response to biotic and abiotic stress
J. Plant Physiol., Volume 163, 2006, pp. 1167–1178
G.Y. Zhang, M. Chen, L.C. Li, Z.S. Xu, X.P. Chen, J.M. Guo, Y.Z. Ma
Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought and diseases in transgenic tobacco
Transcriptional modulation of ethylene response factor protein JERF3 in the oxidative stress response enhances tolerance of tobacco seedlings to salt, drought, and freezing
K.R. Jaglo, S. Kleff, K.L. Amundsen, X. Zhang, V. Haake, J.Z. Zhang, T. Deits, M.F. Thomashow
Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold-response pathway are conserved in Brassica napus and other plant species
T.J. Zhao, S. Sun, Y. Liu, J.M. Liu, Q. Liu, Y.B. Yan, H.M. Zhou
Regulating the drought-responsive element (DRE)-mediated signaling pathway by synergic functions of trans-active and trans-inactive DRE binding factors in Brassica napus
Hypoxia induced changes in the lipid peroxidation, membrane permeability, reactive oxygen species generation, and antioxidant response systems in Zea mays leaves