Blog List

Thursday, 16 June 2016

Physical and Chemical Properties of Vertisols and Soil Nutrient Management for Intensive Rice Cultivation in the Mwea Area in Kenya

Author
Motohiko KONDO1), Toshinari OTA, Raphael WANJOGU
1) National Agricultural Research Center
 Released 2010/03/19  

Abstract

Physico-chemical properties of Vertisols in the Mwea area, the major irrigated rice area of Kenya, were investigated to develop recommendations for soil and nutrient management for intensive rice cultivation. Soil depth ranged from 0.8 to 1.8 m with dark clay layers with a heavy texture predominated by montmorillonite. Only a weak horizon differentiation was recognized in the clay layers except for a slight change in the structure with depth. Carbonates as nodules and concretions were commonly detected in deep to shallow layers. The soil chemical fertility was estimated to be medium to high in terms of major essential elements in general, except for K whose amount was found to be rather low in some areas. Available N level was medium to high for Vertisols, but it was obvious that efficient N application was essential to achieve a high yield standard considering the range of soil available N content.
Low yield was often associated with a low topographic position of the fields. In the fields with poor drainage mostly found in depressed areas, strong reduction of soil and high base concentration might disturb the root activity for nutrient uptake.
From the physical viewpoint, difficulty in plowing was a major constraint. Dry tillage could be an option to minimize water percolation into deep layers along cracks to maintain the trafficability. Incorporation of organic matter such as rice straw or upland crop residues is being tested to improve the friability of soil for better workability in dry tillage and drainage, which may also contribute to the recycling of nutrient sources like K.


References

  • 1. BLOKHUIS, W. A. 1982 Morphology and genesis of Vertisols. In: Vertisols and rice soils of the tropics. Symposia papers 2. Transactions of the Twelfth International Congress of Soil Science 23-47.
  • 2. FAO 1985 Fifth meeting for soil correlation and land evaluation. World Soil Resources Reports 56. pp.207.
  • 3. KANTOR, W. and U. SCHWERTMANN 1974 Mineralogy and genesis of clays in red-black soil toposequences on basic igneous rocks in Kenya. J. Soil Sci. 25: 67-78.
  • 4. KAWAGUCHI, K and K. KYUMA 1977 Paddy soils in tropical Asia. The University Press of Hawaii. pp.258.
  • 5. MIYAKE, M. M. ISMUNADJI, I. ZULKARNAINI and S. ROECHAN 1984 Phosphate response of rice in Indonesian paddy fields. Technical Bulletin No 17, TARC. pp.78.
  • 6. MOBERG, J. P. and I. E. ESU 1991 Characteristics and compositions of some savanna soils in Nigeria. Geoderma 48: 113-129.
  • 7. OHU, J. O., E. I. EKWUE and O. A. FOLORUNSO 1994 The effect of addition of organic matter on the compaction of a Vertisol from Northern Nigeria. Soil Technology 7: 155-162.
  • 8. YOSHIDA, S and Y. HAYAKAWA 1970 Effects of mineral nutrition on tillering of rice. Soil Sci. Plant Nutri. 16: 186-191.

For further details log on website :
https://www.jstage.jst.go.jp/article/jsta1957/45/2/45_2_126/_article

Mechanism and Inheritance of Resistance to Rice Tungro Disease in Rice Varieties Basmati 370 and IR 50

Author
Hiroshi NEMOTO1), Hashim HABIBUDDIN2)
1) Tropical Agriculture Research Center 2) Malaysian Agricultural Research and Development Institute
 Released 2010/03/19  

Abstract

Mechanism and inheritance of resistance to rice tungro disease in the rice varieties Basmati 370 and IR 50 were studied. Resistance of Basmati 370 was associated with its resistance to rice tungro spherical virus (RTSV) infection, which was controlled by a single recessive gene. Individual selection for its resistance to RTSV infection in the F2of a cross with a susceptible variety was effective in securing resistance in the F3. The RTSV resistance showed a genetic relation with heading date and grain width. Resistance of IR 50 was associated with its resistance to the green leafhopper (GLH), which was controlled by a single partially dominant gene. Individual selection for GLH resistance in the F2of a cross with a susceptible variety was ineffective in securing resistance in the F3. However, line selection in the F5was effective in securing resistance to GLH and virus infection in the later generations. Resistance to GLH in IR 50 was not related to heading date, culm length, panicle length, grain shape or resistance to the brown planthopper.

References 

  • 1. ABU KASSIM, A. and H. HABIBUDDIN 1986 Virus diseases of rice and leguminous crops in Malaysia. Trop. Agr. Res. Ser. 19: 33-39.
  • 2. ATHWAL, D. S., M. D. PATHAK, E. H. BACALANGCO and C. D. PURA 1971 Genetics of resistance to brown planthoppers and green leafhoppers in Oryza sativa L.. Crop Sci. 11: 747-750.
  • 3. BAJET, N. B., R. D. DAQUIOAG and H. HIBINO 1985 Enzymelinked immunosorbent assay to diagnose rice tungro. J. Plant Prot. Tropics 2: 125-130.
  • 4. CLARK, M. F. and A. N. ADAMS 1977 Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 34: 475-483.
  • 5. DAQUIOAG, R. D., E. R. TIONGCO and H. HIBINO 1984 Reaction of several rice varieties to rice tungro virus (RTV) complex. Int. Rice Res. Newsl. 9 (2) : 5-6.
  • 6. HABIBUDDIN, H., N. K. Ho and T. TAKITA 1987 Research and management of tungro disease in Peninsular Malaysia. In Proc. of workshop on rice tungro virus. Ministry of Agr. and AARDMAROS Res. Inst. for Food Crops, Indonesia 86-91.
  • 7. HIBINO, H., M. ROECHAN and S. SUDARISMAN 1978 Association of two types of virus particles with Penyakit Habang (tungro disease) of rice in Indonesia. Phytopathology 68: 1412-1416.
  • 8. HIBINO, H., N. SALEH and M. ROECHAN 1979 Transmission of two kinds of rice tungroassociated viruses by insect vectors. Phytopathology 69: 1266-1268.
  • 9. HIBINO, H., N. SALEH and M. ROECHAN 1987 Rice tungro virus disease: Current research and prospects. In Proc. of workshop on rice tungro virus. Ministry of Agr. and AARD-MAROS Res. Inst. for Food Crops, Indonesia.
  • 10. HIBINO, H., DAQUIOAG, P. Q. CABAUTAN and G. DAHAL 1988 Resistance to rice tungro spherical virus in rice. Plant Disease 72: 843-847.
  • 11. KHUSH, G. S. and D. S. BRAR 1991 Genetics of resistance to insects in crop plants. Advances in Agronomy 45: 223-274.
  • 12. KOBAYASHI, A., M. A. SUPAAD and O. OTHMAN 1983 Inheritance of resistance of rice of tungro and biotype selection of green leafhopper in Malaysia. JARQ 16: 306-311.
  • 13. MANWAN, I., S. SAMA and S. A. RIZIVI 1985 Use of varietal rotation in the management of tungro disease in Indonesia. Indonesian Agr. Res. and Develop. J. 7: 43-48.
  • 14. NEMOTO, H., H. HABIBUDDIN, Y. H. CHEN and K. HADZIM 1995 Breakdown of resistance of a rice line MR 118 to rice tungro disease in Peninsular Malaysia. Breeding Science 45: 281-285.
  • 15. PATHAK, M. D., C. H. CHENG and M. E. FORTUNO 1969 Resistance to Nephotettix cincticeps and Nilaparvata lugens in varieties of rice. Nature 223: 502-504.
  • 16. REZAUL KARIM, A. N. M. and M. D. PATHAK 1982 New genes for resistance to green leafhopper Nephotettix virescens (Distant) in rice, Oryza sativa L.. Crop Protection 1: 483-490.
  • 17. SAITO, Y., H. HIBINO, T. OMURA and T. USUGI 1981 Transmission of rice tungro bacilliform virus and rice tungro spherical virus by leafhopper vectors. Proc. 5th. Int. Cong. Virology: 213.
  • 18. SIWI, B. H. and G. S. KHUSH 1977 New genes for resistance to the green leafhopper in rice. Crop Sci.17: 17-20.
  • 19. TAKITA, T. and H. HABIBUDDIN 1985 Relationship between laboratory-developed biotypes of green leafhopper and resistant varieties of rice in Malaysia. JARQ 19: 219-223.


For further details log on website :
https://www.jstage.jst.go.jp/article/jsta1957/42/2/42_2_111/_article

Inheritance patterns and identification of microsatellite markers linked to the rice blast resistance in BC2F1 population of rice breeding

Author
Gous Miah 1   , Mohd Y. Rafii 1   2   *  , Mohd Razi Ismail 1   2   , Adam Bin Puteh 2   , Harun Abdul Rahim 3   , Sadegh Ashkani 1   4   , Abdul Latif 2   5  
1Universiti Putra Malaysia, Institute of Tropical Agriculture, Laboratory of Food Crops, 43400 UPM Serdang, Selangor, Malaysia.
2Universiti Putra Malaysia, Faculty of Agriculture, Department of Crop Science, 43400 UPM Serdang, Selangor, Malaysia.
3Malaysian Nuclear Agency, Agrotechnology and Bioscience Division, 43000 Kajang, Selangor, Malaysia.
4Islamic Azad University, Shahr-e-Rey Branch, Department of Agronomy and Plant Breeding, Tehran, Iran.
5Bangladesh Rice Research Institute, Gazipur 1701, Bangladesh.

The BC2F1 population was derived from a cross between rice variety, MR219 (susceptible to blast) and Pongsu Seribu 1 (resistant to blast). The objectives of this research were to know the inheritance pattern of blast resistance and to identify the linked markers associated with blast resistance in BC2F1 population. Sixteen microsatellite markers were found as polymorphic between the parents related to blast resistant genes (Pi-genes). Among the selected blast resistant linked markers, two markers RM6836 and RM8225 showed expected testcross ratio (1:1) for single-gene model in the BC2F1 population with the association between resistant and susceptible progeny. A total of 333-BC2F1 plants were challenged with the most virulent pathotype P7.2 of Magnaporthe oryzae. Chi-square (χ2) analysis for phenotypic segregation in single-gene model showed goodness of fit (P = 0.4463) to the expected segregation ratio (1:1). In marker segregation analysis, two polymorphic markers (RM6836 and RM8225) clearly showed goodness of fit to the expected segregation testcross ratio (1:1) for the single-gene model. The marker RM8225 and RM6836 showed significant R2 values higher than 10 for the trait of the blast lesions degree (BLD). The positions of RM6836 and RM8225 markers on rice chromosome 6 and the distance between these two markers is 0.2 cM. We conclude that single dominant gene control the blast resistance in Pongsu Seribu 1 located on chromosome 6, which is linked to RM8225 and RM6836 microsatellite markers. This information could be useful in marker-assisted selection for blast resistance in rice breeding involving Pongsu Seribu 1.
Key words: blast inheritance; microsatellite markers; BC2F1 population; rice variety
1 INTRODUCTION
The evolution of new biotypes of pests and diseases, as well as the pressures of climate change, pose serious challenges to rice breeders, who would like to increase rice production by introducing resistance to multiple biotic and abiotic stresses (Miah et al., 2013). Among the biotic stresses, blast disease is the most harmful threat to high productivity of rice (Li et al., 2007). Rice blast caused by Magnaporthe oryzae (M. oryzae) is the most devastating diseases of rice worldwide (Khush & Jena, 2009; Liu et al., 2010). Rice blast severely reduces production in both irrigated and water stressed upland ecosystems of tropical and temperate countries (Suh et al., 2009). The incorporation of blast resistance genes into cultivars is the most preferential strategy in rice breeding program to prevent this disease. Most of the major resistance genes follow gene-for-gene interaction model (Kumbhar et al., 2013). Utilization of genetic resistance is the most effective and environmentally friendly strategy for control of the disease (Zhu et al., 2004).
Knowledge on the inheritance of disease resistance would facilitate the adoption of appropriate breeding strategies and improve the efficiency of selection procedures. Extensive studies have been conducted on inheritance of blast resistance using Japanese races and identified 13 dominant resistance genes at eight different loci (Kiyosawa, 1981). The inheritance of resistance in cultivars against two races of M. oryzae was studied and 11 dominant genes were identified (He & Shen, 1990). Expression of resistance is altered by modifiers or multiple alleles. There is very little information on the inheritance and nature of resistance utilizing tropical isolates of M. oryzae (Filippi & Prabhu, 1996). The nature of resistance and susceptibility is influenced by inoculation techniques, environmental conditions, human mistakes in scoring and the virulence of M. oryzae (Srinivasachary et al., 2002).
Most of the blast R genes are dominant, and some of them are quantitative in nature (Xu et al., 2008). Furthermore, many R genes are located as gene clusters with focuses on chromosomes 6, 9, 11, and 12 (Ashkani et al., 2013; Ballini et al., 2008). Disease resistance is controlled by one or two (Padmavathi et al., 2005; Sharma et al., 2007), three (Mohanty & Gangopadhyay, 1982) or more pair of genes (Flores-Gaxiola et al., 1983). The traditional rice cultivars have one or two dominant resistance genes, which are effective against each fungal isolate (Mackill et al., 1985).
Normally, DNA markers are used to detect resistance genes (Ballini et al., 2008). Identification of resistance genes in genetically diversified rice material is important for identification of new sources of blast resistance. Pongsu Seribu 1 is a Malaysian traditional rice variety which is resistant to blast diseases, can be used as a blast resistant donor in rice breeding programs. It has mid-late maturity, tall plant stature with short grain type, developed by Malaysian Agricultural Research and Development Institute (MARDI). The commercial Malaysian indica rice variety MR219 has been classified as highly productive (Fasahat et al., 2012) but became susceptible to blast. Grain weight is as high as 28–30 mg, and 200 grains/panicle (Alias, 2002). A short maturation period of 105–111 days is the additional good feature of this variety. The aims of this study were to know the inheritance pattern of blast resistance in BC2F1 rice population against pathotype P7.2 isolate and to identify microsatellite markers linked to blast resistance. Inheritance of this highly effective source of blast resistance Pongsu Seribu 1 should determine for its efficient use in the rice-breeding programs targeted for improving blast resistance.
2 MATERIAL AND METHOD
MR219 is a high yielding, good eating quality and wide adaptability rice variety. Unfortunately, this cultivar is very susceptible to blast (Figure 1). The MR219-rice cultivar was used as the recurrent parent while the cultivar Pongsu Seribu 1(PS1) was used as donor for the blast resistance (Figure 2). Among the F1 plants, two heterozygous F1plants were selected and backcrossed with “MR219” to generate the BC1F1s. In the BC1F1 plants, marker-assisted foreground selection was carried out and the markers RM6836 and RM8225 showed heterozygous plants. The heterozygous plants were used to estimate the recurrent genome recovery using background marker. Out of 70-polymorphic microsatellite background markers, at least four SSR background markers per rice chromosome were used for analysis of recurrent genome recovery in each generation. The highest recurrent genome recovery plants were subjected to phenotypic selection. The best four plants (i.e those that have phenotypically resemblance to the recurrent parent with maximum recurrent genome recovery) were backcrossed with MR219 to develop the BC2F1seeds. The BC2F1 plants were inoculated with the most virulent pathotype P7.2 and also subjected to foreground selection followed by phenotypic selection to identify best plants heterozygous for blast resistance with maximum recovery for recurrent parent genome (RPG).
Figure 1 Rice cultivars Pongsu Seribu 1 (PS1) (resistant) and MR219 (susceptible) inoculated with pathotype 7.2 of M. oryzae. Severe blast lesions were observed in MR219 and no lesions in PS1. 
Figure 2 Crossing and selection scheme to produce blast resistant BC2F1 genotypes. 
One of the most virulent Malaysian rice blast pathotype P7.2 of M. oryzae was collected from the Malaysian Agricultural Research and Development Institute (MARDI). Currently, this pathotype is the most virulent pathogen in Malaysia (Rahim et al., 2013). Potato dextrose agar (PDA) was used as a media for growing the selected pathotype P7.2 of M. oryzae. PDA was prepared by mixing 39g of PDA in 500 ml of distilled water and boiled for 30 minutes in order to dissolve properly. After that, distilled water up to 1.0 L was added into the solution and was autoclaved at 121 °C for 20 minutes. Before plating PDA media, 10 mg of streptomycin was added for every 250 ml media to avoid bacterial contamination. The solution was then poured in Petri dish under the laminar flow cabinet and sealed with parafilm to avoid contamination. The blast conidial suspensions were filtered through nylon gauze mesh and adjusted to a concentration of 1.5 × 105 conidia’s mL–1 by haemocytometer using deionized water. Before inoculation, 0.05% Tween 20 was added to the suspension to increase the adhesion of the spores to the plant leaves.
The BC2F1 seeds were soaked in water for one day and germinated on moist Whatman filter paper in Petri dishes for 3 days in a 30 °C dark incubator. The germinated seeds were transferred in plastic trays (60 cm × 60 cm x 50 cm) containing 15 kg of soil with NPK (10 g of 15:15:15) as described by Prabhu et al. (2003). Plants were grown in a glasshouse at 25-30 °C for 3 weeks, until they were at the four-leaf stage. A total of 333 BC2F1 seedlings were inoculated with highly virulent pathotype P7.2 of M. oryzae to investigate the segregation patterns of blast resistance phenotypically. Twenty one-day-old plants were inoculated by spraying with aqueous spore suspension onto the leaves until run-off. The relative humidity (RH) was maintained at above 90% by covering them with black netting, as well as watering them two to three times during the daytime. Disease scoring was carried out nine (9) days after inoculation based on the Standard Evaluation System (SES) of the International Rice Research Institute (IRRI, 1996). The blast lesion degrees (BLD) were scored using a scale 0-9 as follows: 0= no evidence of infection; 1= brown specks(<0.5 mm in diameter); 2= brown lesions of 0.5–1 mm in diameter; 3= 1-3 mm in diameter with gray centers and brown margins; 4= typical spindle-shaped blast lesion 3 mm or longer, less than 4% of the leaf area infected; 5= typical blast lesion, 3 mm or longer in diameter, infected 4-10% leaf area; 6= typical blast lesions, 3 mm or longer in diameter, infected 11-25% leaf area; 7= typical blast lesions, 3 mm or longer in diameter, infected 26-50% leaf area; 8= typical blast lesions, 3 mm or longer, infected 51-75% leaf area; and 9= typical blast lesions, 3 mm or longer, infected more than 75% leaf area. In the case of single-gene model analysis, the rice plants showing lesion types 0 to 3 were considered as resistant and the plants showing lesions type 4 and above were considered to be susceptible to the selected pathotype P7.2 in BC2F1 population. Plant disease reaction was categorized according to Singh et al. (2012) with some modification.
Total genomic DNA was extracted from fresh leaves of 4-week-old individual plants using the modified CTAB (hexadecyltrimethylammonium bromide) method as described by Doyle & Doyle, (1990). DNA was quantified by using nano-drop spectrophotometry (ND1000 Spectrophotometer). The diluted DNA samples diluted with 1xTE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) to get a concentration of 70 ng/μl and kept in the refrigerator at –20 °C for PCR analysis.
Total sixteen microsatellites with known chromosomal positions distributed on rice chromosomes were selected from the Gramene database (www.gramene.org) related to blast resistance genes (McCouch et al., 2002; Temnykh et al., 2000). Parental lines were used to identify polymorphic markers related to rice blast resistance gene. PCR reactions with microsatellite markers were carried out in 15-μl reactions containing 1 μl (70 ng) of genomic DNA, 1.0 μM of each primer, 7.4 μl master mix and 4.6 μl nuclease-free water. PCR amplification was carried out in a thermocycler (T100TM, Bio-Rad) using an initial denaturation at 94 °C for 5 minutes followed by 35 cycles of denaturation at 94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for 30 seconds, the final extension at 72 °C for 5 minutes, followed by rapid cooling to 4 °C prior to analysis. For electrophoresis, 3.0% metaphorTM agarose (Lonza) gel was prepared containing 1μl Midori green in 1X TBE buffer (0.05 M Tris, 0.05 M boric acid, 1 mM EDTA, pH 8.0). The gel was run at constant voltage of 80V for 80 minutes and visualized using Molecular Imager® (GelDocTM XR, Bio-Rad).
For marker genotyping, the clearly SSR bands were scored manually. The plants that showed a pattern similar to the susceptible parent alleles were scored as “aa” and those with a banding pattern similar to the resistant parent alleles were scored as “AA”, and the heterozygous plants were scored as “Aa”.
Chi-square (χ2) test was performed to test the goodness of fit of the BC2F1 population for the phenotypic and marker data by comparing the observed frequency distribution with an expected one. Chi-square analysis for goodness of fit to the backcross type of segregation was performed as mentioned by Tartarini (1996). The chi-square analysis for the genotypic and phenotypic ratio was calculated by using the formula, χ2 = (O - E)2 / E, where O is the observed value, and E is the expected value. For the single-gene model, the chi-square value was considered as significant (p≤0.05) if its value was higher than 3.84. Frequency of disease reaction trait was analyzed using SPSS ver. 16.0. Single-marker analysis was carried out according to Divya et al. (2014) to know the association between the markers and trait of blast incidence.
3 RESULTS AND DISCUSSION
The frequency distribution of blast disease evaluation for the trait of the blast lesions degree (BLD) is shown in Figure 3. The susceptible parent MR219 showed highly susceptible reaction with lesions type 5 to 7 score; whereas the parent Pongsu Seribu 1 was found to be resistant producing lesions type 0 to 2 under artificial inoculation in the glasshouse (Figures 1-3). Among the 333 BC2F1 plants, 159 plants showed resistant reaction and 174 plants showed susceptible reaction (Table 1). The observed frequencies, when tested for goodness of fit with chi-square (χ2) test for single-gene model, showed goodness of fit (P = 0.4463) to the expected segregation testcross ratio (1:1) (Table 1). Therefore, resistance to blast pathotype P7.2 in Pongsu Seribu 1 is most likely controlled by a single dominant gene. The testcross progeny phenotypically segregated into a ratio of 1R:1S. Present studies are in agreement with findings of Bhatt et al. (1994), Mackill & Bonman (1992) for inheritance of blast resistance in rice and Beyer et al. (2011) for inheritance of Russian wheat aphid resistance in wheat. Several scientists reported that blast resistance is governed by dominant genes (Bhatt et al., 1994; Yamasak & Kiyosawa, 1966), but in a few cases the resistance was also reported due to recessive genes (Bhatt et al., 1994; Yu et al., 1987). This situation is in agreement with the statement that the ability of a plant to express resistance is also dependent on the genotype of the pathogen. A rice plant cannot be resistant to an isolate of M. oryzae unless the pathogen has a gene that makes it virulent to the rice plant. An isolate of M. oryzae cannot be avirulent on the rice plant unless the rice plant has genes that make it resistant to that isolate (Ellingboe & Chao, 1994). The findings of monogenic inheritance of a dominant nature resistance are in agreement with the results of several scientists (Orellana et al., 1980; Xue & Chen, 1987). The expression of the gene depends on the virulent gene(s) present in the fungus. Previous studies showed resistance to blast is governed either by a single gene or a polygenic system, depending on the genotypes or cultivars, as well as their specificity to M. oryzae isolates, where resistance to blast disease is host specific and effective against only specific strains of M. oryzae (Zhou et al., 2007). However, studies conducted in IRRI revealed that most of the traditional varieties have one or two dominant genes (Mackill et al., 1985). Our result is in agreement with a blast research done at IRRI in the Philippines, which indicated that one or two dominant genes present in the cultivars confer complete resistance against each fungal isolate (Yu et al., 1987).
Figure 3 Frequency distribution of blast lesions degree (BLD) in BC2F1 population inoculated with rice blast pathotype P7.2. The mean scores of two parents are indicated by arrows. 
Table 1 Phenotypic segregation of blast resistance in BC2F1 population obtained from a cross between rice cultivars MR219 × Pongsu Seribu 1 inoculated with pathotype P7.2 of M. oryzae 
GenotypesTotal seedlingsResistant (R)Susceptible (S)Expected ratioχ2 valueP-value
MR219 (P1)1280128---
PS1 (P2)1281280---
F12828----
BC2F13331591741:10.580.4463
A total of 16 polymorphic markers were found as the linked marker for blast resistance (Table 2). All linked markers were tested in F1 population. In BC1F1 generation, two markers (RM6836 and RM8225 markers) showed heterozygous plants. Using other foreground markers none of plants were found as heterozygous condition which indicates that some blast resistant gene disappeared due to the backcrossed with MR219. This statement is more coincide with the findings of Suh et al. (2009) who found that some genes were lost during the recombination process in segregating generations of advanced backcross lines. The two polymorphic (RM6836 -238bp and RM8225 -212bp) linked markers were used to evaluate BC2F1 progenies. These two markers located on chromosome 6 of rice showed linkage with resistance and susceptibility in BC2F1 progeny. The banding patterns of two polymorphic markers RM6836 and RM8225 linked with Pi genes in F1 and BC2F1 population for 14 samples along with two parents are shown in Figure 4 and Figure 5, respectively. The position of RM6836 (54.3 cM) and RM8225 (54.1 cM) markers are shown in Figure 6. These two markers are 0.2 cM apart from each other on chromosome 6 of rice. Fjellstrom et al. (2006) and Rathour et al. (2008) mentioned that markers RM8225 and RM6836 are tightly linked with Pizgene located on chromosome 6, whereas Rathour et al. (2008) found that these two markers located at distance of 1.2-4.5 cM from the gene. Results indicate that individuals of the BC2F1 population (derived from Pongsu Seribu 1) had the alleles linked with these two microsatellite markers resistant against pathotype P7.2 of M. oryzae. This finding has potential use in marker-assisted selection to develop rice cultivars with blast resistance genes in rice breeding programs. Because these markers had high-selection accuracy for resistant plant sources, they can be used in MAS for the resistant gene.
Table 2 Information of polymorphic microsatellite blast resistant linked markers 
Markers nameChr.Primer sequences (5ꞌ-3ꞌ)
Product size (bp)Linked genes
Forward primerReverse primer
RM1683TGCTGCTTGCCTGCTTCCTTTGAAACGAATCAATCCACGGC116Candidate gene- Oxalate oxidase, 14-3-3 protein
RM4135GGCGATTCTTGGATGAAGAGTCCCCACCAATCTTGTCTTC79Pi-26
RM596111GTATGCTCCTCCTCACCTGCACATGCGACGTGATGTGAAC129Pi-7(t)
RM68366TGTTGCATATGGTGCTATTTGAGATACGGCTTCTAGGCCAAA240Pi-z,Pi-2,Pi-9, Pi-8,Pi-3, PIi
RM82256ATGCGTGTTCAGAAATTAGGTTGTTGTATACCTCATCGACAG221Pi-z
RM10112GTGAATGGTCAAGTGACTTAGGTGGCACACAACATGTTCCCTCCCATGC324Pi-6(t)
RM22411ATCGATCGATCTTCACGAGGTGCTATAAAAGGCATTCGGG157Pi-k,Pi-sh, Pilm2,Pi-18(t)
RM1401TGCCTCTTCCCTGGCTCCCCTGGGCATGCCGAATGAAATGCATG261Pi-37(t),Pi-24(t)
RM51TGCAACTTCTAGCTGCTCGAGCATCCGATCTTGATGGG113qtl (qLs1)
RM2614CTACTTCTCCCCTTGTGTCGTGTACCATCGCCAAATCTCC125Pi-21
RM3406GGTAAATGGACAATCCTATGGGACAAATATAAGGGCAGTGTGC163Pi-tq1
RM5478TAGGTTGGCAGACCTTTTCGGTCAAGATCATCCTCGTAGCG235Pi-11(t)
RM4951AATCCAAGGTGCAGAGATGGCAACGATGACGAACACAACC159Pi-t
RM2513GAATGGCAATGGCGCTAGATGCGGTTCAAGATTCGATC147qtl
RM22911CACTCACACGAACGACTGACCGCAGGTTCTTGTGAAATGT116Pi-7(t)
RM24712TAGTGCCGATCGATGTAACGCATATGGTTTTGACAAAGCG131Pi-20(t),Pi-ta
Figure 4 Genotyping with markers RM6836 and RM8225 linked to blast resistance genes in F1 population of rice derived from MR219 × Pongsu Seribu 1 (PS1). Running on 3% metaphor agarose gel stained with midori green, only 14 samples plus the two parents for each marker are shown (M=50 bp ladder). 
Figure 5 Genotyping with markers RM6836 and RM8225 linked to blast resistance genes in BC2F1 population of rice derived from MR219 × Pongsu Seribu 1 (PS1). Running on 3% metaphor agarose gel stained with midori green, only 14 samples plus the two parents for each marker are shown (M=50 bp ladder). 
Figure 6 The position of RM6836 and RM8225 markers on rice chromosome 6. 
A total of 333 plants of BC2F1 population were evaluated with the linked markers. The observed segregation ratio for resistance and susceptibility in BC2F1 lines for 16 polymorphic microsatellite markers is shown in table 3. The chi-square (χ2) analysis for RM6836 and RM8225 showed a good fit to the expected testcross ratio (1:1) for a single-gene model (d.f. = 1.0, p>0.05) in BC2F1 population (Table 3). The rest of the markers did not fit the expected segregating Mendelian ratios. Results indicate that RM6836 and RM8225 have an association with blast resistance gene against to pathotype P7.2 of M. oryzae in rice.
Table 3 Marker segregation analysis in BC2F1 population derived from a cross between rice varieties MR219 × Pongsu Seribu 1 
MarkersChromosomeMarker analysis
χ2 (1:1)Probability
Aaaa
RM16830333331<.0001
RM41350333331<.0001
RM5961110333331<.0001
RM683661621710.200.6547
RM822561561771.200.2733
RM101120333311<.0001
RM224110333331<.0001
RM14010333331<.0001
RM510333331<.0001
RM26140333331<.0001
RM34060333331<.0001
RM54780333331<.0001
RM49510333331<.0001
RM25130333331<.0001
RM229110333331<.0001
RM247120333331<.0001
The segregation ratio was not in agreement with the expected Mendelian ratio for other polymorphic markers in BC2F1 population. This is due to the fact that, none of the plants found as heterozygous condition using other foreground markers. In chi-square analyses, two microsatellite markers showed an expected testcross segregation ratio of 1:1, inherited in simple Mendelian fashion. Phenotypic data for disease reaction of resistance and susceptibility to blast pathotype P7.2 also segregated in 1R:1S ratio in the BC2F1 population. So, we can conclude that resistance to blast pathotype P7.2 in Pongsu Seribu 1 is controlled by a single dominant gene. The plants resistant to blast pathotype P7.2 from BC2F1 lines had genotypes with microsatellite markers RM8225 and RM6836, these markers could be used for marker-assisted selection. The existence of Pongsu Seribu 1 with individual blast resistance genes provides a powerful tool for future studies on the rice blast disease. The virulence patterns of blast races (pathotype P7.2) will be easier to study with lines possessing known resistance genes. Moreover, it should be easier to identify additional resistance genes. This blast resistant Pongsu Seribu 1 is currently being used to tag the resistance genes using microsatellite markers. This information can be useful in practical breeding programs as well as in the eventual cloning of the resistance genes.
Marker trait association was performed using SPSS ver. 16.0 software to identify the association of resistance component trait with linked polymorphic markers of the blast resistance gene. The genotypic segregation data set of the linked microsatellite markers generated from the BC2F1 population combined with phenotypic segregation data for blast resistance trait. This data was subjected to linear model regression analysis and significance of R2was identified using F value comparison. The marker RM8225 and RM6836 showed significant R2 values higher than 10 for the trait of the blast lesions degree (BLD) (Table 4). We conclude that RM6836 and RM8225 are two linked microsatellite markers to blast resistance locus in BC2F1 generation. The deployment of major gene resistance will minimize selection pressure and thereby prevent evolution of resistance in the pathogen population (Bonman et al., 1992). This approach will help breeders to expedite breeding research in crops by enabling a selection based on the genotype rather than on the phenotype. The markers reported here provide rice breeders and geneticists a valuable tool for marker-aided selection of a disease resistance gene.
Table 4 Marker trait association in the BC2F1 population by regression analysi 
TraitsMarkerChromosomePositionR2 value
BLDRM8225654.111.42*
RM6836654.310.82*
*R2 values are significant at p<0.05 level of significance.
ACKNOWLEDGEMENTS
The authors would like to acknowledge Long-term Research Grant Scheme (LRGS), Food Security Project, Ministry of Education, Malaysia, for the financial support to conduct research on rice breeding and the Malaysian Rice Research Centre, MARDI, for helpful discussions on this research.
REFERENCES

Alias, I. (2002). MR219, a new high-yielding rice variety with yields of more than 10 mt/ha. Taipei: Food and Fertilizer Technology Center. [ Links ] 
Ashkani, S., Rafii, M. Y., Rahim, H. A., & Latif, M. A. (2013). Genetic dissection of rice blast resistance by QTL mapping approach using an F3 population. Molecular Biology Reports, 40, 2503-2515.http://dx.doi.org/10.1007/s11033-012-2331-3. PMid:23203411 [ Links ] 
Ballini, E., Morel, J. B., Droc, G., Price, A., Courtois, B., Notteghem, J. L., & Tharreau, D. (2008). A genome-wide meta-analysis of rice blast resistance genes and quantitative trait loci provides new insights into partial and complete resistance. Molecular plant-microbe interactions: MPMI, 21, 859-868. http://dx.doi.org/10.1094/MPMI-21-7-0859. PMid:18533827 [ Links ] 
Beyer, B. M., Haley, S. D., Lapitan, N. L. V., Peng, J. H., & Peairs, F. B. (2011). Inheritance of Russian wheat aphid resistance from tetraploid wheat accessions during transfer to hexaploid wheat. Euphytica, 179, 247-255. http://dx.doi.org/10.1007/s10681-010-0299-4. [ Links ] 
Bhatt, J. C., Singh, R. A., Mani, S. C., & Shoran, J. (1994). Inheritance of blast resistance in rice. Indian Journal of Genetics, 54, 142-148. [ Links ] 
Bonman, J. M., Khush, G. S., & Nelson, R. J. (1992). Breeding rice for resistance to pests. Annual Review of Phytopathology, 30, 507-528. http://dx.doi.org/10.1146/annurev.py.30.090192.002451. [ Links ] 
Divya, B., Robin, S., Rabindran, R., Senthil, S., Raveendran, M., & John Joel, A. (2014). Marker assisted backcross breeding approach to improve blast resistance in Indian rice (. Oryza sativa) variety ADT43Euphytica, 200, 61-77. http://dx.doi.org/10.1007/s10681-014-1146-9. [ Links ] 
Doyle, J. J., & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus (San Francisco, Calif.), 12, 13-15. [ Links ] 
Ellingboe, A. H., & Chao, C. C. T. (1994). Genetic interactions in Magnaporthe grisea that affect cultivar specific avirulence/virulence in rice. In R. S. Zeigler, S. A. Leong, & P. S. Teng (Eds.), Rice blast disease (p. 51-64). Wallingford: CAB International. [ Links ] 
Fasahat, P., Kharidah, M., Aminah, A., & Ratnam, W. (2012). Proximate nutritional composition and antioxidant properties of Oryza rufipogon, a wild rice collected from Malaysia compared to cultivated rice, MR219. Australasian Journal of Crop Science, 6, 1502-1507. [ Links ] 
Filippi, M. C., & Prabhu, A. S. (1996). Inheritance of blast resistance in rice to two races, IB-1 and IB-9. Pyricularia griseaBrazilian Journal of Genetics, 19, 599-604. http://dx.doi.org/10.1590/S0100-84551996000400012. [ Links ] 
Fjellstrom, R., McClung, A. M., & Shank, A. R. (2006). SSR markers closely linked to the locus are useful for selection of blast resistance in a broad array of rice germplasm. Pi-zMolecular Breeding, 17, 149-157. http://dx.doi.org/10.1007/s11032-005-4735-4. [ Links ] 
Flores-Gaxiola, J. A., Nuque, F. L., Crill, J. P., & Khush, G. S. (1983). Inheritance of blast Pyricularia oryzaeresistance in rice. International Rice Research Newsletter, 8, 5-6. [ Links ] 
He, Z. H., & Shen, Z. T. (1990). Studies on blast resistance genes in indica rice. International Rice Research Newsletter, 15, 4. [ Links ] 
International Rice Research Institute – IRRI1996Standard Evaluation System for Rice4thedManilaIRRI [ Links ] 
Khush, G. S., & Jena, K. K. (2009). Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In G. L. Wang, & B. Valent (Eds.), Advances in genetics, genomics and control of rice blast disease (p. 1-10). Dordrecht: Springer. http://dx.doi.org/10.1007/978-1-4020-9500-9_1. [ Links ] 
Kiyosawa, S. (1981). Gene analysis for blast resistance. Oryza, 18, 196-203. [ Links ] 
Kumbhar, S. D., Kulwal, P. L., Patil, J. V., Gaikwad, A. P., & Jadhav, A. S. (2013). Inheritance of blast resistance and identification of SSR marker associated with it in rice cultivar RDN 98-2. Journal of Genetics, 92, 317-321. http://dx.doi.org/10.1007/s12041-013-0255-x. PMid:23970091 [ Links ] 
Li, Y. B., Wu, C. J., Jiang, G. H., Wang, L. Q., & He, Y. Q. (2007). Dynamic analyses of rice blast resistance for the assessment of genetic and environmental effects. Plant Breeding, 126, 541-547. http://dx.doi.org/10.1111/j.1439-0523.2007.01409.x. [ Links ] 
Liu, J., Wang, X., Mitchell, T., Hu, Y., Liu, X., Dai, L., & Wang, G. L. (2010). Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction. Molecular Plant Pathology, 11, 419-427. http://dx.doi.org/10.1111/j.1364-3703.2009.00607.x. PMid:20447289 [ Links ] 
Mackill, D. J., & Bonman, J. M. (1992). Inheritance of blast resistance in near-isogenic lines of rice. Phytopathology, 82, 746-749. http://dx.doi.org/10.1094/Phyto-82-746. [ Links ] 
Mackill, D. J., Bonman, J. M., Suh, H. S., & Srilingam, R. (1985). Genes for resistance to Philippine isolates of the rice blast pathogen. Rice Genetics Newsletter, 2, 80-81. [ Links ] 
McCouch, S. R., Teytelman, L., Xu, Y., Lobos, K. B., Clare, K., Walton, M., Fu, B., Maghirang, R., Li, Z., Xing, Y., Zhang, Q., Kono, I., Yano, M., Fjellstrom, R., DeClerck, G., Schneider, D., Cartinhour, S., Ware, D., & Stein, L. (2002). Development of 2240 new SSR markers for rice. DNA Research, 9, 199-220. http://dx.doi.org/10.1093/dnares/9.6.199. PMid:12597276 [ Links ] 
Miah, G., Rafii, M. Y., Ismail, M. R., Puteh, A. B., Rahim, H. A., Islam, KhN., & Latif, M. A. (2013). A review of microsatellite markers and their applications in rice breeding programs to improve blast disease resistance. International Journal of Molecular Sciences, 14, 22499-22528. http://dx.doi.org/10.3390/ijms141122499. PMid:24240810 [ Links ] 
Mohanty, C. R., & Gangopadhyay, S. (1982). Testing of blast resistance in F rice seedlings in different doses of nitrogen and seasons. 2Annals of the Phytopathological Society of Japan, 48, 648-658. http://dx.doi.org/10.3186/jjphytopath.48.648. [ Links ] 
Orellana, P., Martinez, J., & Hernandez, A. (1980). Some aspects of the inheritance of resistance of rice () to Pyricularia oryzae. Oryza sativaCiencia Y Ticnica en la Agricultura Arroz, 3, 23-33. [ Links ] 
Padmavathi, G., Ram, T., Satyanarayana, K., & Mishra, B. (2005). Identification of blast (Magnaporthe grisea) resistance genes in rice. Current Science, 88, 628-630. [ Links ] 
Prabhu, A. S., Castro, E. M., Araujo, L. G., & Berni, R. F. (2003). Resistance spectra of six elite breeding lines of upland rice to Pyricularia grisea.Pesquisa Agropecuaria Brasileira, 38, 203-210. http://dx.doi.org/10.1590/S0100-204X2003000200006. [ Links ] 
Rahim, H. A., Bhuiyan, M. A. R., Saad, A., Azhar, M., & Wickneswari, R. (2013). Identification of virulent pathotypes causing rice blast disease ( population derived from Pongsu Seribu 2 × Mahshuri. Magnaporthe oryzae) and study on single nuclear gene inheritance of blast resistance in F2Australian Journal of Crop Science, 7, 1597-1605. [ Links ] 
Rathour, R., Chopra, M., & Sharma, T. R. (2008). Development and validation of microsatellite markers linked to the rice blast resistance gene of Fukunishiki and Zenith. PizEuphytica, 163, 275-282. http://dx.doi.org/10.1007/s10681-008-9646-0. [ Links ] 
Sharma, R. C., Shrestha, S. M., & Pandey, M. P. (2007). Inheritance of blast resistance and associated microsatellite markers in rice cultivar ‘Laxmi’. Journal of Phytopathology, 155, 749-753.http://dx.doi.org/10.1111/j.1439-0434.2007.01298.x. [ Links ] 
Singh, A., Singh, V. K., Singh, S. P., Pandian, R. T. P., Ellur, R. K., Singh, D., Bhowmick, P. K., Gopala Krishnan, S., Nagarajan, M., Vinod, K. K., Singh, U. D., Prabhu, K. V., Sharma, T. R., Mohapatra, T., & Singh, A. K. (2012). Molecular breeding for the development of multiple disease resistance in Basmati rice. AoB PLANTS, 2012, 1-13.http://dx.doi.org/10.1093/aobpla/pls029. PMid:23125910 [ Links ] 
Srinivasachary , Hittalmani, S., Shivayogi, S., Vaishali, M. G., Shashidar, H. E., & Kumar, K. G. (2002). Genetic analysis of rice blast fungus of souther Karnataka using DNA marker and reaction of popular rice genotypes. Current Science, 82, 732-735. [ Links ] 
Suh, J. P., Roh, J. H., Cho, Y. C., Han, S. S., Kim, Y. G., & Jena, K. K. (2009). The pi40 gene for durable resistance to rice blast and molecular analysis of pi40-advanced backcross breeding lines. Phytopathology, 99, 243-250. http://dx.doi.org/10.1094/PHYTO-99-3-0243. PMid:19203276 [ Links ] 
Tartarini, S. (1996). RAPD markers linked to the Vf gene for scab resistance in apple. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 92, 803-810. http://dx.doi.org/10.1007/BF00221891. PMid:24166544 [ Links ] 
Temnykh, S., Park, W. D., Ayers, N., Cartinhour, S., Hauck, N., Lipovich, L., Cho, Y. G., Ishii, T., & McCouch, S. R. (2000). Mapping and genome organization of microsatellite sequences in rice ( L.). Oryza sativaTheoretical and Applied Genetics, 100, 697-712. http://dx.doi.org/10.1007/s001220051342. [ Links ] 
Xu, X., Chen, H., Fujimura, T., & Kawasaki, S. (2008). Fine mapping of a strong QTL of field resistance against rice blast, Pikahei-1(t), from upland rice Kahei, utilizing a novel resistance evaluation system in the greenhouse. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 117, 997-1008. http://dx.doi.org/10.1007/s00122-008-0839-7. PMid:18758744 [ Links ] 
Xue, Q. Z., & Chen, H. S. (1987). Genetic study of disease resistance in Dan 209, a rice cultivar bred by anther culture. Acta Genetics Sinica, 14, 349-354. [ Links ] 
Yamasak, Y. I., & Kiyosawa, S. (1966). Studies on inheritance of resistance of rice varieties to blast. I. Inheritance of resistance of Japanese varieties to several strains of the fungus. Bulletin of the National Institute of Agricultural Sciences, 14, 39-69. [ Links ] 
Yu, H. Z., Mackill, D. J., & Bonman, J. M. (1987). Inheritance of resistance to blast in some traditional and improved rice cultivars. Phytopathology, 77, 323-326. http://dx.doi.org/10.1094/Phyto-77-323. [ Links ] 
Zhou, E., Jia, Y., Singh, P., Correll, J. C., & Lee, F. N. (2007). Instability of the Magnaporthe oryzae avirulence gene AVR-Pita alters virulence. Fungal genetics and biology: FG & B, 44, 1024-1034.http://dx.doi.org/10.1016/j.fgb.2007.02.003. PMid:17387027 [ Links ] 
Zhu, M., Wang, L., & Pan, Q. (2004). Identification and characterization of a new blast resistance gene located on rice chromosome 1 through linkage and differential analyses. Phytopathology, 94, 515-519.http://dx.doi.org/10.1094/PHYTO.2004.94.5.515. PMid:18943771 [ Links ] 
Received: September 11, 2014; Accepted: October 09, 2014
*Corresponding author: mrafii@upm.edu.my
Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

For further details log on website :
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0006-87052015000100033

Advantages and Disadvantages of Fasting for Runners

Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...