Everything About Wood

Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.

Blog List

Thursday, 8 December 2016

Association Mapping and Marker Development of Genes for Starch Lysophospholipid Synthesis in Rice

Published Date
November 2016, Vol.23(6):287–296, doi:10.1016/j.rsci.2016.09.002
Open Access, Creative Commons license, Funding information

Author 
  • Tong Chuan a,b,,
  •  
  • Liu Lei c
  •  
  • Daniel L.E. Waters c
  •  
  • Bao Jin-song a
  • aInstitute of Nuclear Agricultural Sciences, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029, China
  • bInstitute of Food Science, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
  • cSouthern Cross Plant Science, Southern Cross University, Lismore, NSW 2480, Australia
Received 25 July 2016. Accepted 22 September 2016. Available online 16 November 2016. Managing Editor: Li Guan

Abstract

Phospholipids are a major kind of lipids in rice grains and have fundamental nutritional and functional benefits to the plant. Their lyso forms (lysophospholipids, LPLs) often form inclusion complexes with amylose or independently influence the physicochemical and functional properties of rice starch. However, the genetic basis for LPL synthesis in rice endosperm is largely unknown. Here, we performed a preliminary association test of 13 LPL compositions among 20 rice accessions, and identified 22 putative main-effect quantitative trait loci responsible for all LPLs except for LPC14:0 and LPE14:0. Five derived cleaved amplified polymorphic sequences and one insertion/deletion marker for three LPL-synthesis-related candidate genes were developed. Association analysis revealed two markers significantly associated with starch LPL traits. These results provide an insight into the genetic basis of phospholipid biosynthesis in rice and may contribute to the rice quality breeding programs using functional markers.

Keywords

  • rice
  • starch lysophospholipid
  • phospholipid biosynthesis
  • grain quality
  • QTL
  • molecular marker

  • association mapping

  • Rice (Oryza sativa L.) has long been cultivated and consumed worldwide as a vital nutritional source. It satisfies over 21% of the daily calorie needs of the world's population (Zhan et al., 2014). According to the reported world rice statistics from the International Rice Research Institute (http://www.irri.org), the global paddy rice and milled rice productions were 700 and 565 million tons in 2015, respectively. Besides the sustained challenge of rice yield, with the increasing of living standards, rice quality improvement has also been a new mission for meeting the consumer's demands (Ren et al., 2015).

    To date, functional lipids in rice grains have greatly attracted considerable attentions owing to their nutritional and healthy benefits. As a major class of complex lipids in cereal grains, phospholipids (PLs) serve as one of the necessary bioactive components of cell membranes by forming lipid bilayers. Increasingly emerging evidences have shown that PLs play a pivotal biological role in clathrin-mediated endocytosis, phagocytosis and macropinocytosis (Bohdanowicz and Grinstein, 2013). According to different involved hydrophilic heads, such as choline, ethanolamine, inositol and serine, the PLs in organisms are mainly comprised of phosphatidylcholine (PC), phosphatidy- lethanolamine (PE), phosphatidylinositol, phosphati- dylserine and the corresponding lyso forms of different PLs (Choi et al., 2005 and Liu et al., 2013). In contrast to other classes of lipids, PLs in rice grains only account for a relatively minor proportion, however, they make a great contribution to the physicochemical and nutritional properties of grains via combining with starch to form complexes in endosperm (Maniñgat and Juliano, 1980, Putseys et al., 2010 and Tong et al., 2015). For example, Tong et al (2015) found that lysophospholipids (LPLs) have significant correlations with pasting properties, the important traits of eating quality of rice, such as cool paste viscosity, breakdown and consistency. Although a number of experiments investigating the components, fractions, contents, structural and distribution features of rice PLs have been reported (Choi et al., 2005 and Yoshida et al., 2011), the broadly diverse results are possibly owing to the different genotypes and environmental effects (Choi et al., 2005, Liu et al., 2014 and Tong et al., 2014).
    The results obtained when PLs begin to accumulate in plants are controversial. For example, Shewry et al (1973) found that PL synthesis occurred as early as seed germination imbibition, whereas others indicated it took place during the stage of rice seed ripening and was unchanged during storage (Nakamura et al., 1958 and Perry and Harwood, 1993). However, the importance to uncover the biosynthesis of PL compositions in plants cannot be overstressed. Hence, a lot of efforts were made to illuminate the underlying genetic network. Several PL-synthesis-related enzymes and biosynthetic genes have been reported. For instance, acetyl-CoA carboxylase (Acc1) influences the length distribution of acyl-chain by regulating the relative proportion of C16 versus C18 fatty acids during lipid synthesis (Hofbauer et al., 2014). INO1, a structure gene encoding inositol-3-phosphate synthase of PL biosynthesis, has been found in yeast (Gaspar et al., 2011). Three major genes cdsA, pgsA and pgpPparticipate in the PL biosynthetic steps of cytidine triphosphate to cytidine diphosphate-diacylglycerol, cytidine diphosphate-diacylglycerol to phosphate- dylclycerolphosphate, and phosphatidylclycerolphosphate to phosphatidyldlycerol, respectively (Martin et al., 1999 and Kuhn et al., 2015). Two Mg2+-dependent phosphatidic acid phosphohydrolases (PAH1 and PAH2) have been characterized in Arabidopsis, and they catalyze the first committed step of choline synthesis and define a special PC biosynthetic pathway at endo- plasmic reticulum (Eastmond et al., 2010 and Farquharson, 2010). Fatty acid desaturase 2 is negatively correlated with oleic acid composition while positively correlated with linoleic acid composition in maize (Li et al., 2013). The seed gene phospholipase D (PLD) controlling the degradation of PL membranes of oil bodies has also been mapped in rice (Suzuki, 2011a, b).
    At present, since the enzymes participating in starch PL biosynthesis in rice have just been scarcely identified, the specific biosynthetic pathway of starch PLs in rice is still unclear. A possible and modified biosynthetic network of PLs in rice is outlined based on the studies on animals and yeasts (Fig. 1) (Kinney, 1993 and Liu et al., 2013). Cytidinediphosphate-diacyglycerol and 1,2-diacylglycerol are both originated from phosphatidic acid after the acylation by cytidine- diphosphate-diacylglycerol synthase and phosphatidate- phosphohydrolase. Their main synthetic pathways have been reported (Fig. 1) (Liu et al., 2013). Especially, PE maybe produced from the reactions of three enzymes, phosphatidylserine decarboxylase, aminoalcoholphospho- transferase (AAPT) and ethanolaminephosphotransferase, while PC is probably produced by displacement through phospholipid N-methyltransferase, AAPT and cholinephosphotransferase. Interestingly, AAPT is a common enzyme mediating the biosyntheses of PC and PE. LPLs, such as lysophosphatidic acid, are possibly produced from the hydrolysis of diacylphospholipids by phospholipase A2 (Fig. 1).

    Fig. 1. Conceivable biosynthetic pathways of phospholipids in cereals.
    Drawn based on Kinney (1993), D’Arrigo and Servi (2010) and Liu et al (2013).
    E, Ethanolamine; ME, Methylethanolamine; DME, Dimethylethanolamine; IP3, inositol 1,4,5-triphosphate; LPA, Lysophosphatidic acid; C, Choline; P, Phosphate; CDP, Cytidinediphosphate; PE, Phosphatidylethanolamine; PME, Phosphatidylmethylethanolamine; PDME, Phosphatidyldimethyle- thanolamine; PC, Phosphatidylcholine; PS, Phosphatidylserine; PI, Phosphatidylinositol; PIP, Phosphatidylinositol phosphate; PIP2, Phosphati- dylinositolbisphosphate; PGP, Phosphoglycerol phosphate; PG, Phosphatidylglycerol; DPG, Diphosphatidylglycerol; , Glycerol-3-phosphate acyltransferase; , 1-monoacylglycerol-3-phosphate acyltransferase; , CDP-diacylglycerol synthase (CTP: phosphatidatecytidylyltransferase); , Phosphatidatephosphohydrolase; , PI synthase (CDP-diacylglycerol: myo-inositol phosphatidyltransferase); , PI 4-kinase (ATP: phosphati- dylinositol-4-phosphotransferase); , PIP kinase (ATP: phosphatidylinositol 4-phosphate 5-phosphotransferase); , PGP synthase (CDP-diacylgly- cerolphosphatidyltransferase); , PGP phosphatase (phosphatidylglycerol-phosphate phosphohydrolase); , CDP diacylglycerolphosphatidly- transerase; , PS synthase (CDP-diacylglycerol: L-serine O-phosphatidyltransferase); , PS decarboxylase; , PE N-methyltransferase; , Phospholipid N-methyltransferase; , Aminoalcoholphosphotransferase; , Ethanolaminephosphotransferase (CDP-ethanolamine: 1,2-diacylglycerol cytidylyltransferase); , Ethanolamine phosphate cytidylyltransferase (CTP: ethanolamine phosphate cytidylyltransferase); , Ethanolamine kinase (ATP: ethanolamine phosphotransferase); , Cholinephosphotransferase (CDP-choline: 1,2-diacylglycerol cytidylyltransferase); , Choline phosphate cytidylyltransferase (CTP: choline phosphate cytidylyltransferase); , Choline kinase (ATP: choline phosphotransferase); , Phospholipase D (PLD) (Phosphatidylcholinephosphatidohydrolase); , Phospholipase C (PLC); , Diacylglycerol (DAG) kinase; , Phospholipase A2 (PLA2).

    Quantitative trait loci (QTLs) responsible for lipid synthesis in rice have been reported (Liu et al., 2009, Qin et al., 2010, Shen et al., 2012 and Ying et al., 2012). Ying et al (2012) identified 29 QTLs associated with fatty acid composition and oil concentration, and some of them are strongly associated with the rice ortholog genes acyl-CoA:diacylglycerol acyltransferase (DGAT) and acyl-ACP thioesterase (FatB). Shen et al (2012) identified three fat-content-related QTLs that are stably expressed in different environments and populations. Similarly, 7 and 14 QTLs for rice lipids were identified via different doubled haploid populations under diverse environments, respectively (Liu et al., 2009 and Qin et al., 2010). These QTLs may contribute to improving rice nutritional quality via marker-assisted breeding. However, QTL analysis of rice starch lipids has not been reported.
    The objectives of this study were to identify the QTLs or genetic loci for rice starch LPL content and composition across different environments, identify LPL-synthesis-related candidate genes and develop molecular markers for these candidate genes, and confirm whether these molecular markers are associated with LPL traits.

    Materials and Methods

    Rice materials

    Two sets of rice accessions were used. Set 1 planted at Lingshui, Hainan Province, China, in 2010 and 2011 included 20 non-waxy rice accessions (G01–G20), of which 8 belong to japonica subspecies, 8 indica subspecies and 4 the aus group (Xu et al., 2014). Set 2 planted at Hangzhou, Zhejiang Province, China, in 2012 had 13 local accessions (R01–R13), 2 waxy accessions and 11 non-waxy accessions, including 3 japonica subspecies and 8 indica subspecies (Liu et al., 2014).

    Rice starch LPLs

    The endosperm LPL contents of the above two sets of rice have been previously reported (Liu et al., 2014, Tong et al., 2014 and Tong et al., 2015).

    Genotypes and association mapping

    For the 20 non-waxy rice accessions (G01–G20), the public genotype data were available on the website of Gramene (http://www.gramene.org/). A total of 32 655 common single nucleotide polymorphism (SNP) sites were downloaded (Xu et al., 2014). Association mapping was performed using the genome association and prediction integrated tool (Lipka et al., 2012). Analyses of population structure (Q) and optimum number of populations were conducted using the STRUCTURE software (Xu et al., 2014). When comparing the values of Bayesian information criterion (BIC), the optimal model based on kinship (K), population structure and principal components (P) for individual LPL trait was selected (Xu et al., 2014). The BIC results with the best model were presented at the significance level of P < 0.001.

    DNA extraction

    Genomic DNA was extracted from the fresh leaf tissues of plants grown in the greenhouse using a modified cetyltrimethyl ammonium bromide procedure according to Doyle (1991). DNA concentrations were estimated using a NanoDrop 2000 spectrophotometer (Thermo, San Jose, CA).

    Sequencing, development of derived cleaved amplified polymorphic sequences (dCAPS) and insertion/deletion (InDel) markers, and genotyping

    According to the physical positions of QTLs, putative genes responsible for LPL biosynthesis were identified. For these candidate genes, part of their sequences in the 20 rice accessions of Set 1 were amplified by appropriate PCR primer sets (Supplemental Table 1), which were synthesized by Shanghai Sangon Company (Shanghai, China).
    Table 1. Genome-wide significantly associated QTLs for rice lysophospholipids (LPLs).
    TraitYearModelQTLChrPosition a
    (bp)
    P-valueMajor alleleMinor alleleMinor allele frequencyAllelic effect (R2)
    LPC16:02011KqC160-6-1626 685 9674.72 × 10-3CT0.300.8011
    2012KqC160-6-263 235 5604.41 × 10-3GA0.250.5573
    qC160-888 481 0843.64 × 10-3AG0.400.5872
    LPC18:12012Q+KqC181-2214 522 5443.15 × 10-3GA0.200.8346
    qC181-1127 729 6014.20 × 10-3CT0.300.8107
    LPC18:22011KqC182-9915 125 6384.37 × 10-3CT0.200.5585
    2012KqC182-111117 847 7964.07 × 10-3AT0.300.5698
    LPC18:32011KqC183-1123 517 1833.27 × 10-3AC0.250.6047
    2012KqC183-1123 517 1834.89 × 10-3AC0.250.5411
    TLPC2011ANOVAqC-5523 465 1864.20 × 10-3GA0.250.5647
    qC-9915 125 6382.62 × 10-3CT0.200.6409
    qC-121221 175 3923.73 × 10-3TA0.250.5835
    2012KqC-10105 339 2584.36 × 10-3GA0.250.5589
    LPE16:02011ANOVAqE160-116 971 5253.33 × 10-3GA0.250.6016
    LPE18:12011Q+KqE181-2214 522 5443.26 × 10-3GA0.200.7802
    2012Q+KqE181-2214 522 5442.17 × 10-3GA0.200.8364
    LPE18:22011KqE182-1123 585 3603.23 × 10-3CT0.250.6064
    qE182-4431 271 4744.23 × 10-3TC0.200.5637
    qE182-111117 943 1183.82 × 10-3TA0.350.5798
    LPE18:32011KqE183-1123 517 1834.27 × 10-3AC0.250.5623
    2012KqE183-1123 517 1834.33 × 10-3AC0.250.5600
    TLPE2011ANOVAqE-10105 339 2584.69 × 10-3GA0.250.5477
    TLPL2011ANOVAqL-9915 125 6382.92 × 10-3CT0.200.6229
    qL-10105 339 2584.67 × 10-3GA0.250.5482
    qL-121221 175 3924.93 × 10-3TA0.250.5399
    2012KqL-10105 339 2584.19 × 10-3GA0.250.5649
    LPC14:0, 1-myristoyl-2-hydroxy-sn-glycero-3-phosphocholine; LPC16:0, 1-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine; LPC18:1, 1-oleoyl- 2-hydroxy-sn-glycero-3-phosphocholine; LPC18:2, 1-linoleoyl-2-hydroxy-sn-glycero-3-phosphocholine; LPC18:3, 1-linolenoyl-2-hydroxy-sn- glycero-3-phosphocholine; LPE14:0, 1-myristoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine; LPE16:0, 1-palmitoyl-2-hydroxy-sn-glycero-3- phosphoethanolamine; LPE18:1, 1-oleoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine; LPE18:2, 1-linoleoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine; LPE18:3, 1-linolenoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine; TLPC, Total lysophosphatidylcholine; TLPE, Total lysophosphatidylethanolamine; TLPL, Total lysophospholipid; Q, Population structure; K, Kinship; ANOVA, Analysis of variance; Chr, Chromosome.
    • a
      Position in base pairs for the leading SNP of rice sequence.
    For gel-based analysis, PCR was performed in 50 μL system with 50 ng genomic DNA, 25 μL of 2× Master Mix (including 2× PCR buffer, 4 mmol/L MgCl2, 0.4 mmol/L dNTPs, 50 U/mL high-fidelity Taq DNA polymerase) and 5 μL of each 10 μmol/L primer. PCR was run under the following conditions: pre-denature at 94 °C for 5 min; followed by 34 cycles of denature at 94 °C for 45 s, anneal at 55 °C for 1 min and extension at 72 °C for 45 s; and final extension at 72 °C for 8 min. Later, 2 μL PCR products were detected by 2% denaturing agarose gels, and the remaining PCR products were sent to Shanghai Sangon Company (Shanghai, China) for sequencing.
    For detection of SNPs in the polymorphic sites of the sequenced candidate genes, the derived cleaved amplified polymorphic sequence markers were developed based on the web-based free software dCAPS Finder 2.0 (Konieczny and Ausubel, 1993and Neff et al., 1998). The InDel marker was developed using software Primer Premier 5.0. These markers were used to genotype both the two sets of rice materials. Amplified PCR products (3 μL) were digested with 1 U restriction endonuclease. Then, 8% denaturing polyacrylamide gel was used to separate the digested products, and gel images were acquired using the VersaDoc Imaging System Model 3000 (Bio-Rad Laboratories, USA).

    Statistical analysis

    Analysis of variance with the general linear model procedure was used to detect the associations between different endosperm LPL traits and marker alleles, which was conducted using the software TASSEL (version 2.1). The P-value of significance was set at P < 0.05.

    Results

    Identification of QTLs for starch LPLs

    A preliminary association test was conducted based on the optimal model, and 22 main-effect QTLs were identified for all the individual LPLs excluding LPC14:0 and LPE14:0 which distributed on all chromosomes except for chromosomes 3 and 7 (Table 1 and Fig. 2). The Manhattan plots for individual LPL contents showing significant peaks represented the identified main-effect QTLs on different chromosomes (Fig. 3). Three QTLs responsible for LPC16:0 were identified. qC160-6-1 was detected on chromosome 6 in 2011, while qC160-6-2 and qC160-8 were identified on chromosomes 6 and 8 in 2012, respectively. For LPC18:1, two significant QTLs were discovered on chromosomes 1 and 2, respectively, in these two years. Two loci for LPC18:2, qC182-9 and qC182-11, were identified. The QTL qC183-1 for LPC18:3 was consistently detected on chromosome 1 in both 2011 and 2012. Four QTLs for total LPC were identified, including qC-5, qC-9 and qC-12 in 2011 and qC-10 in 2012. Only one QTL for LPE16:0, qE160-1, was detected on chromosome 1 in 2011. Similarly, qE181-2 for LPE18:1 and qE183-1 for LPE18:3 were consistently discovered on chromosomes 2 and 1, respectively, in two years. Three QTLs for LPE18:2 were detected only in 2011. Only one QTL for total LPE, qE-10, was discovered on chromosome 10 in 2011. A total of three QTLs were detected for total LPL. Among them, qL-10 was detected in two years.
    Fig. 2. Location of QTLs for rice starch lysophospholipids (LPLs) on chromosomes (Chr).
    C160, C181, C182, C183, E160, E181, E182, E183, C, E and L in the QTLs represent LPC16:0, LPC18:1, LPC18:2, LPC18:3, LPE16:0, LPE18:1, LPE18:2, LPE18:3, total lysophosphatidylcholine, total lysophosphatidylethanolamine and total lysophospholipid, respectively.
    Fig. 3. Manhattan plots of association test for total lysophospholipid.

    Candidate gene identification and sequencing, marker development, and genotyping

    Based on the physical positions of the associated QTLs, three QTLs were found to be closed to the loci Os06g0204400 (5 276 639–5 286 101 bp on chromosome 6) (qC160-6-2), Os06g0649900 (26 575 128–26 579 581 bp on chromosome 6) (qC160-6-1) and Os11g0546600 (20 174 656–20 176 341 on chromosome 11) (qC182-11 and qE182-11), respectively, which encode AAPT, PLD and phospholipase A2 (PLA2), respectively. Therefore, these three candidate genes involved in PL metabolism were re-sequenced to investigate the associations between functional nucleotide polymorphisms and variations in individual LPLs. Specific primers (data not shown) were designed according to the sequences downloaded from National Center of Biotechnology Information to amplify the partial sequences of these three candidate genes (< 800 bp). After sequence alignment of these three genes in the 20 rice accessions of Set 1, several InDels and SNPs were discovered (Fig. 4). Among these polymorphisms, a 7-bp insertion in AAPT and five SNPs in AAPT, PLD and PLA2 were selected for developing molecular markers. Six functional molecular markers (Table 2) were developed and used to genotype 33 rice accessions from Set 1 and Set 2. Among the 20 accessions of Set 1, genotyping results (Table 3 and Fig. 5) showed that T/A and A/G variants in AAPT, C/A and G/C variants in PLD, and G/T variant in PLA2 were consistent with the sequencing results.
    Fig. 4. Part sequence alignments of AAPT and PLA2 genes.
    A, InDel found in AAPT gene among G01–G20; B, Single nucleotide polymorphism found in PLA2gene among G01–G20.
    AAPT, Aminoalcoholphosphotransferase; PLA2, Phospholipase A2.
    Table 2. Primers for enzyme digestion of several single nucleotide polymorphisms.
    PrimerTypeSequence (5′–3′)PCR product (bp)Restriction enzymeEnzyme digestion product (bp)
    AAPT1-FInDelCCAGCCTTGTTTCAATACCTG134/127––
    AAPT1-RAAATGTAGGAAGTTTTTACTTGC
    AAPT2-FdCAPSAAGAGCAAGTAAAAACTTCCTAAATT222ApoI22, 200
    AAPT2-RGATACAAATGCCCAAATACCA
    AAPT3-FdCAPSCAAAGATCAATGCTGGGTAATTTC184SphI22, 162
    AAPT3-RAGGTAAATCAGTTCACCTGTGCA
    PLD1-FdCAPSCATCCTGCACTAAAAACAGTTGAAT214HinfI22, 192
    PLD1-RTGCACAACACCAGAGCCCCACC
    PLD2-FdCAPSCCTCCCAAAGTTTAGGCGGAAAAGGCC187HpaII27, 160
    PLD2-RTCAAAGCTCACAATAGCAGAATA
    PLA21-FdCAPSTTCCTATTGTTTCTTCCTCCCTCTT230HinfI20, 210
    PLA21-RGAAAAAACAAAATTAAAAAAGAGT
    dCAPS, Development of derived cleaved amplified polymorphic sequences.
    Underlined letter means the mismatch base.
    Table 3. Summary of alleles of three candidate genes.
    AccessionAAPT1AAPT2AAPT3PLD1PLD2PLA21AccessionAAPT1AAPT2AAPT3PLD1PLD2PLA21
    G01DTACGGG18IAGCCG
    G02DTACGGG19DTACGT
    G03DTAACTG20IAGACT
    G04DTAACGR01DTACCG
    G05DTACCTR02DTACCG
    G06DTACGGR03DTACGT
    G07DTACGGR04DTACCG
    G08DTACCTR05DTACCT
    G09DTACGGR06DTACCG
    G10DTAACTR07DTACGG
    G11DTACGGR08IAGCCG
    G12DTACCTR09DTACCT
    G13DTACCTR10IAGCCT
    G14IAGCCTR11DTACCT
    G15DTACCGR12DTACCT
    G16DTACGGR13IAGCCT
    G17IAGCCG
    AAPT, Aminoalcoholphosphotransferase; PLD, Phospholipase D; PLA2, Phospholipase A2; I, Insertion; D, Deletion.
    Fig. 5. Polymorphism of InDel and simple nucleotide polymorphisms in AAPT, PLD and PLA2genes in rice accessions G01–G20 and R01–R13.
    AAPT, Aminoalcoholphosphotransferase; PLD, Phospholipase D; PLA2, Phospholipase A2.
    Lanes from left to right in each part are marker, G01–G20 and R01–R13, respectively.

    Association test between starch LPL traits and molecular markers

    Taking account into the trace LPL content in waxy rice, the association analysis between molecular markers and endosperm LPLs was performed based on 31 non-waxy accessions and all the 33 rice accessions. It was found that PLD1 marker was significantly associated with LPC16:0 in 31 non-waxy rice accessions but not in all the 33 rice accessions. Contrarily, PLA21 marker was significantly associated with LPC18:1 in all the 33 rice accessions but not in 31 non-waxy rice accessions (Table 4). Some other markers were also significantly correlated with several individual LPL traits in 31 or all the 33 rice accessions, but these results were not in accordant with the target QTLs detected in 20 rice accessions (data not shown).
    Table 4. Marker loci associated with starch lysophospholipids (LPLs) traits detected with analysis of variance (ANOVA) model in 31 non-waxy and all the 33 rice accessions.
    GeneMarkerTraitNon-waxy accession (31)

    All rice accession (33)

    QTL
    p_MarkerR2_Markerp_MarkerR2_Marker
    PLDPLD1LPC16:00.01490.18760.09840.0856qC160-6-1
    PLA2PLA21LPC18:20.09020.09580.02770.1468qC182-11, qE182-11
    PLD, Phospholipase D; PLA2, Phospholipase A2.

    DISCUSSION

    Although biosynthesis of the lipids, such as triacylglycerol and PLs, and their metabolisms in plants have received substantial attention (Bessoule and Moreau, 2004, Ambrosewicz-Walacik et al., 2015 and Xu and Shanklin, 2016), the understanding of plant PL synthesis pathway and its regulation was limited to several genes responsible for Arabidopsis phospholipid biosynthesis, such as Phosphoethanolamine N-methyl- transferase (PEAMT), Choline kinase (CKI), cytidine triphosphate-phosphocholinecytidylytransferase (CCT) and AAPT (Eastmond et al., 2010). Genetic analysis of rice PL is necessary not only for understanding PL biosynthesis in rice plants, but also for breeding rice varieties with optimized PL accumulation in grains. To our knowledge, only a few genes corresponding to rice starch LPL synthesis have been reported.
    Association mapping is a mature and widely accepted technology to identify the genotype- phenotype relationships among diverse germplasms (Yang et al., 2014). For example, 74 QTLs significantly associated with maize kernel oil content and fatty acid composition have been identified by association mapping (Li et al., 2013). In this study, association mapping identified 22 main-effect QTLs for rice endosperm LPL concentration and composition on all chromosomes except chromosomes 3 and 7 (Fig. 2). This is the first study on the genetic basis of rice LPL content (Table 1 and Fig. 2). Especially, we discovered that six QTLs located on chromosomes 1, 2, 9, 10, 11 and 12, respectively, simultaneously controlled more than two LPL traits (Table 1and Fig. 2). It maybe indicate that a tight physiological and biochemical link exists during the biosynthesis or regulation of these LPL components. It was worth noting that qE-10, qC-10 and qL-10 located on the close positions on chromosome 10 (Fig. 2), probably indicating a locus regulating starch LPL accumulation in rice. Additionally, qE183-1, qC183-1, qE181-2 and qL-10 were simultaneously detected in different environments (Table 1), which demonstrated that they were highly stable for LPE18:3, LPC18:3, LPE18:1 and total LPL across different environments. More importantly, the QTLs qC160-6-2, qC160-6-1 and qC182-11/qE182-11 were close to the loci Os06g0204400, Os06g0649900 and Os11g0546600, respectively. Three genes were evidenced to encode AAPT, PLD and PLA2 which were vital enzymes mediating PL synthesis in plants (Fig. 1). Since the other novel QTLs with minor effect were only detected in one environment, they might be affected by environment or genotype × environment interaction. Additionally, it should be noted that no QTL was found for LPC14:0 and LPE14:0, which might due to the small population. Therefore, a large population is necessary for detecting the significant QTLs for LPC14:0 and LPE14:0.
    Because of the small amount of SNPs used in the preliminary association test, we cannot confirm that the detected significant SNPs were right in the candidate genes. Thus, we re-sequenced the three candidate genes and discovered some SNPs and one InDel (Fig. 4). We further developed dCAPS to genotype some of these SNPs to test whether there were real associations between the SNPs of candidate genes and the LPL content in rice grains. If there were some relationships, these markers can be used for improving rice starch LPLs during molecular breeding. Analysis of variance showed that PLD1 locus was significantly correlated with LPC16:0 and total LPC content (P < 0.05, Table 4). PLA21 was significantly correlated with LPC18:1 and LPC18:2 contents (P < 0.05, Table 4). Thus, the gene markers of both PLD1 and PLA21 associated with qC160-6-1 (LPC16:0) and qC182-11 (LPC18:2) were confirmed (Table 1 and Table 4). However, some gene markers were not associated with the target traits but with other traits. For example, the AAPT1, AAPT2 and AAPT3 markers were all significantly associated with both LPE18:2 and LPE18:3 contents, respectively (data not shown). Further studies using a large rice population and more SNPs are necessary for understanding the genetic architecture of rice starch LPLs.
    In summary, a total of 22 QTLs responsible for individual LPL content were identified via a preliminary association test. Three candidate genes responsible for LPL biosynthesis were discovered, and their partial sequences were sequenced. Among the identified nucleotide variations, five dCAPS and one InDel markers for these three candidate genes were successfully developed. Two markers were confirmed to be associated with the target LPL traits. This study provides an insight into the genetic basis of LPL biosynthesis in rice and may contribute to the rice quality breeding programs using the functional markers derived from the candidate genes.

    ACKNOWLEDGEMENT

    This work was financially supported by the Fundamental Research Funds for the Central Universities at Zhejiang University, Hangzhou, China (Grant No. 2016XZZX001-09).

    Appendix A Supplementary data

    • PDF (76K)

    REFERENCES

      • Ambrosewicz-Walacik et al., 2015
      • M. Ambrosewicz-Walacik, M. Tańska, D. Rotkiewicz
      • Phospholipids of rapeseeds and rapeseed oils: Factors determining their content and technological significance: A review
      • Food Rev Int, Volume 31, Issue 4, 2015, pp. 385–400
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (3)
      • Bessoule and Moreau, 2004
      • J.J. Bessoule, P. Moreau
      • Phospholipid synthesis and dynamics in plant cells
      • In: Daum G. Lipid Metabolism and Membrane Biogenesis, 2004, Springer, Berlin, Germany, pp. 89–124
      • View Record in Scopus
        Citing articles (12)
      • Bohdanowicz and Grinstein, 2013
      • M. Bohdanowicz, S. Grinstein
      • Role of phospholipids in endocytosis, phagocytosis, and macropinocytosis
      • Physiol Rev, Volume 93, Issue 1, 2013, pp. 69–106
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (62)
      • Choi et al., 2005
      • S.K. Choi, E. Takahashi, O. Inatsu, Y. Mano, M. Ohnishi
      • Component fatty acids of acidic glycerophospholipids in rice grains: Universal order of unsaturation index in each lipid among varieties
      • J Oleo Sci, Volume 54, Issue 7, 2005, pp. 369–373
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (6)
      • D’Arrigo and Servi, 2010
      • P. D’Arrigo, S. Servi
      • Synthesis of lysophospholipids
      • Molecules, Volume 15, 2010, pp. 1354–1377
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (44)
      • Doyle, 1991
      • J. Doyle
      • DNA protocols for plants: CTAB total DNA isolation
      • Molecular Techniques in Taxonomy., G.M. Hewitt, A. Johnston, 1991, Springer, Berlin, Germany, pp. 283–293
      • View Record in Scopus
        Citing articles (14)
      • Eastmond et al., 2010
      • P.J. Eastmond, A.L. Quettier, J.T.M. Kroon, C. Craddock, N. Adams, A.R. Slabas
      • PHOSPHATIDIC ACID PHOSPHOHYDRO- LASE1 and 2 regulate phospholipid synthesis at the endoplasmic reticulum in Arabidopsis
      • Plant Cell, Volume 22, Issue 8, 2010, pp. 2796–2811
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (71)
      • Farquharson, 2010
      • K.L. Farquharson
      • Regulation of phospholipid biosynthesis in Arabidopsis
      • Plant Cell, Volume 22, Issue 8, 2010, p. 2527
      • View Record in Scopus
         | 
        CrossRef
      • Gaspar et al., 2011
      • M.L. Gaspar, H.F. Hofbauer, S.D. Kohlwein, S.A. Henry
      • Coordination of storage lipid synthesis and membrane biogenesis evidence for cross-talk between triacylglycerol metabolism and phosphatidylinositol synthesis
      • J Biol Chem, Volume 286, Issue 3, 2011, pp. 1696–1708
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (30)
      • Hofbauer et al., 2014
      • H.F. Hofbauer, F.H. Schopf, H. Schleifer, O.L. Knittelfelder, B. Pieber, G.N. Rechberger, H. Wolinski, M.L. Gaspar, C.O. Kappe, J. Stadlmann, K. Mechtler, A. Zenz, K. Lohner, O. Tehlivets, S.A. Henry, S.D. Kohlwein
      • Regulation of gene expression through a transcriptional repressor that senses acyl-chain length in membrane phospholipids
      • Dev Cell, Volume 29, Issue 6, 2014, pp. 729–739
      • Article
         | 
         PDF (1944 K)
         | 
        View Record in Scopus
        Citing articles (15)
      • Kinney, 1993
      • A.J. Kinney
      • Phospholipid head groups
      • Lipid Metabolism in Plants., T.S.J. Moore, 1993, CRC Press, Boca Raton, Florida, USA, pp. 259–284
      • View Record in Scopus
      • Kuhn et al., 2015
      • S. Kuhn, C.J. Slavetinsky, A. Peschel
      • Synthesis and function of phospholipids in Staphylococcus aureus
      • Int J Med Microbiol, Volume 305, Issue 2, 2015, pp. 196–202
      • Article
         | 
         PDF (1104 K)
         | 
        View Record in Scopus
        Citing articles (7)
      • Konieczny and Ausubel, 1993
      • A. Konieczny, F.M. Ausubel
      • A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR- based markers
      • Plant J, Volume 4, Issue 2, 1993, pp. 403–410
      • View Record in Scopus
        Citing articles (1165)
      • Li et al., 2013
      • H. Li, Z.Y. Peng, X.H. Yang, W.D. Wang, J.J. Fu, J.H. Wang, Y.J. Han, Y.C. Chai, T.T. Guo, N. Yang, J. Liu, M.L. Warburton, Y.B. Cheng, X.M. Hao, P. Zhang, J.Y. Zhao, Y.J. Liu, G.Y. Wang, J.S. Li, J.B. Yan
      • Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels
      • Nat Genet, Volume 45, Issue 1, 2013, pp. 43–50
      • View Record in Scopus
        Citing articles (124)
      • Lipka et al., 2012
      • A.E. Lipka, F. Tian, Q.S. Wang, J. Peiffer, M. Li, P.J. Bradbury, M.A. Gore, E.S. Buckler, Z.W. Zhang
      • GAPIT: Genome association and prediction integrated tool
      • Bioinformatics, Volume 28, Issue 18, 2012, pp. 2397–2399
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (192)
      • Liu et al., 2013
      • L. Liu, D.L.E. Waters, T.J. Rose, J.S. Bao, G.J. King
      • Phospholipids in rice: Significance in grain quality and health benefits: A review
      • Food Chem, Volume 139, Issue 1/2/3/4, 2013, pp. 1133–1145
      • Article
         | 
         PDF (2581 K)
         | 
        View Record in Scopus
        Citing articles (22)
      • Liu et al., 2014
      • L. Liu, C. Tong, J.S. Bao, D.L.E. Waters, T.J. Rose, G.J. King
      • Determination of starch lysophospholipids in rice using liquid chromatography-mass spectrometry (LC-MS)
      • J Agric Food Chem, Volume 62, Issue 28, 2014, pp. 6600–6607
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (9)
      • Liu et al., 2009
      • W.J. Liu, J. Zeng, G.H. Jiang, Y.Q. He
      • QTLs identification of crude fat content in brown rice and its genetic basis analysis using DH and two backcross populations
      • Euphytica, Volume 169, Issue 2, 2009, pp. 197–205
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (7)
      • Maniñgat and Juliano, 1980
      • C.C. Maniñgat, B.O. Juliano
      • Starch lipids and their effect on rice starch properties
      • Starch Stärke, Volume 32, Issue 3, 1980, pp. 76–82
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (71)
      • Martin et al., 1999
      • P.K. Martin, T. Li, D.X. Sun, D.P. Biek, M.B. Schmid
      • Role in cell permeability of an essential two-component system in Staphylococcus aureus
      • J Bacteriol, Volume 181, Issue 12, 1999, pp. 3666–3673
      • View Record in Scopus
        Citing articles (158)
      • Nakamura et al., 1958
      • A. Nakamura, N.T. Ocirc, S. Funahashi
      • Nature of lysolecithin in rice grains
      • Bull Agric Chem Soc Jpn, Volume 22, Issue 5, 1958, pp. 320–324
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (13)
      • Neff et al., 1998
      • M.M. Neff, J.D. Neff, J. Chory, A.E. Pepper
      • dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: Experimental applications in Arabidopsis thaliana genetics
      • Plant J, Volume 14, Issue 3, 1998, pp. 387–392
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (438)
      • Perry and Harwood, 1993
      • H.J. Perry, J.L. Harwood
      • Radiolabelling studies of acyl lipids in developing seeds of Brassica napus: Use of [1-14C]acetate precursor
      • Phytochemistry, Volume 33, Issue 2, 1993, pp. 329–333
      • Article
         | 
         PDF (570 K)
         | 
        View Record in Scopus
        Citing articles (33)
      • Putseys et al., 2010
      • J.A. Putseys, L. Lamberts, J.A. Delcour
      • Amylose-inclusion complexes: Formation, identity and physico-chemical properties
      • J Cereal Sci, Volume 51, Issue 3, 2010, pp. 238–247
      • Article
         | 
         PDF (314 K)
         | 
        View Record in Scopus
        Citing articles (146)
      • Qin et al., 2010
      • Y. Qin, S.M. Kim, X.H. Zhao, H.S. Lee, B.Y. Jia, K.M. Kim, M.Y. Eun, J.K. Sohn
      • QTL detection and MAS selection efficiency for lipid content in brown rice (Oryza sativa L.)
      • Genes Genom, Volume 32, Issue 6, 2010, pp. 506–512
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (3)
      • Ren et al., 2015
      • J. Ren, X.Q. Zhao, Z.S. Ding, C. Xiang, J. Zhang, C. Wang, J.W. Zhang, C.A. Joseph, Q. Zhang, Y.L. Pang, Y.M. Gao, Y.Y. Shi
      • Dissection and QTL mapping of low-phosphorus tolerance using selected introgression lines in rice
      • Chin J Rice Sci, Volume 29, Issue 1, 2015, pp. 1–13 (in Chinese with English abstract)
      • View Record in Scopus
         | 
        CrossRef
      • Shen et al., 2012
      • Y.Y. Shen, W.W. Zhang, X. Liu, L.M. Chen, S.J. Liu, L.N. Zheng, J.J. Li, Y.L. Chen, T. Wu, Y. Yu, Z.Z. Zhong, L. Jiang, J.M. Wan
      • Identification of two stably expressed QTLs for fat content in rice (Oryza sativa)
      • Genome, Volume 55, Issue 8, 2012, pp. 585–590
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (2)
      • Shewry et al., 1973
      • P.R. Shewry, N.J. Pinfield, A.K. Stobart
      • Phospholipids and the phospholipid fatty acids of germinating hazel seeds (Corylus avellana L.)
      • J Exp Bot, Volume 24, Issue 6, 1973, pp. 1100–1105
      • View Record in Scopus
        Citing articles (6)
      • Suzuki, 2011a
      • Y. Suzuki
      • Isolation and characterization of a rice (Oryza sativa L.) mutant deficient in seed phospholipase D, an enzyme involved in the degradation of oil-body membranes
      • Crop Sci, Volume 51, Issue 2, 2011, pp. 567–573
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (6)
      • Suzuki et al., 2011b
      • Y. Suzuki, Y. Takeuchi, K. Shirasawa
      • Identification of a seed phospholipase D null allele in rice (Oryza sativa L.) and development of SNP markers for phospholipase D deficiency
      • Crop Sci, Volume 51, Issue 5, 2011, pp. 2113–2118
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (4)
      • Tong et al., 2014
      • C. Tong, L. Liu, D.L.E. Waters, T.J. Rose, J.S. Bao, G.J. King
      • Genotypic variation in lysophospholipids of milled rice
      • J Agric Food Chem, Volume 62, Issue 38, 2014, pp. 9353–9361
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (3)
      • Tong et al., 2015
      • C. Tong, L. Liu, D.L.E. Waters, Y. Huang, J.S. Bao
      • The contribution of lysophospholipids to pasting and thermal properties of nonwaxy rice starch
      • Carbohyd Polym, Volume 133, 2015, pp. 187–193
      • Article
         | 
         PDF (498 K)
         | 
        View Record in Scopus
      • Xu and Shanklin, 2016
      • C.C. Xu, J. Shanklin
      • Triacylglycerol metabolism, function, and accumulation in plant vegetative tissues
      • Annu Rev Plant Biol, Volume 67, 2016, pp. 179–206
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (3)
      • Xu et al., 2014
      • F.F. Xu, F.F. Tang, Y.F. Shao, Y.L. Chen, C. Tong, J.S. Bao
      • Genotype × environment interactions for agronomic traits of rice revealed by association mapping
      • Rice Sci, Volume 21, Issue 3, 2014, pp. 133–141
      • Article
         | 
         PDF (1526 K)
         | 
        View Record in Scopus
        Citing articles (13)
      • Yang et al., 2014
      • F. Yang, Y.L. Chen, C. Tong, Y. Huang, F.F. Xu, K.H. Li, H. Corke, M. Sun, J.S. Bao
      • Association mapping of starch physicochemical properties with starch synthesis-related gene markers in nonwaxy rice (Oryza sativa L.)
      • Mol Breeding, Volume 34, Issue 4, 2014, pp. 1747–1763
      • View Record in Scopus
         | 
        CrossRef
        Citing articles (14)
      • Ying et al., 2012
      • J.Z. Ying, J.X. Shan, J.P. Gao, M.Z. Zhu, M. Shi, H.X. Lin
      • Identification of quantitative trait loci for lipid metabolism in rice seeds
      • Mol Plant, Volume 5, Issue 4, 2012, pp. 865–875
      • Article
         | 
         PDF (208 K)
         | 
        View Record in Scopus
         | 
        CrossRef
        Citing articles (16)
      • Yoshida et al., 2011
      • H. Yoshida, T. Tanigawa, N. Yoshida, I. Kuriyama, Y. Tomiyama, Y. Mizushina
      • Lipid components, fatty acid distributions of triacylglycerols and phospholipids in rice brans
      • Food Chem, Volume 129, Issue 2, 2011, pp. 479–484
      • Article
         | 
         PDF (175 K)
         | 
        View Record in Scopus
        Citing articles (16)
      • Zhan et al., 2014
      • X.D. Zhan, P. Yu, Z.C. Lin, D.B. Chen, X.H. Shen, Y.X. Zhang, J.L. Fu, S.H. Cheng, L.Y. Cao
      • QTL mapping of heading date and yield-related traits in rice using a recombination inbred lines (RILs) population derived from BG1/XLJ
      • Chin J Rice Sci, Volume 28, Issue 6, 2014, pp. 570–580 (in Chinese with English abstract)
      • View Record in Scopus
        Citing articles (2)

    • ☆
      Peer review under responsibility of China National Rice Research Institute.
    • ⁎ 
      Corresponding author.
    Open access funded by China National Rice Research Institute

    For further details log on website :
    http://www.sciencedirect.com/science/article/pii/S1672630816300622
    at December 08, 2016 No comments:
    Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest
    Newer Posts Older Posts Home
    Subscribe to: Posts (Atom)

    Advantages and Disadvantages of Fasting for Runners

    Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...

    • Pengalaman bekerja sebagai kerani kilang.
      Assalamualaikum dan salam sejahtera chu olls.     Alhamdulillah sudah seminggu saya melalui pengalaman bermakna ini. Sebagai seorang pel...
    • MIDA- INDUSTRI BERASASKAN KAYU
      Industri berasaskan kayu di Malaysia terdiri daripada  Kayu bergergaji; Venir dan produk panel yang termasuk papan lapis dan produk ...
    • Advantages and Disadvantages of Fasting for Runners
      Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...
    • UKIRAN KAYU DALAM MASYARAKAT MELAYU
      Seni ukiran kayu di kalangan masyarakat Melayu bukan sahaja terdapat pada rumah-rumah tetapi penjelmaan dan penerapannya terdapat pada is...
    • Laboratory Assessment of Forest Soil Respiration Affected by Wildfires under Various Environments of Russia
      International Journal of Ecology Volume 2017 (2017), Article ID 3985631, 10 pages https://doi.org/10.1155/2017/3985631 Author Evgeny  ...
    • Diploma Teknologi Berasaskan Kayu
      LATARBELAKANG POLITEKNIK KOTA KINABALU Politeknik Kota Kinabalu merupakan politeknik yang ketujuh ditubuhkan oleh Kementerian Pendidikan...
    • DIPLOMA REKA BENTUK PERABUT
      Sijil Teknologi Diploma Rekabentuk Perabot Kod Kursus :  K18 ...
    • Motif, Corak dan Ragi Tenun Melayu Riau
      Author MELAYU Riau kaya dengan khazanah budayanya. Antaranya yang amat menonjol adalah motif ornamen Melayunya, yang banyak dipakai untuk ...
    • RUBBER AND PVC FETISHISM
      Rubber fetishism , or  latex fetishism , is the fetishistic attraction to people wearing latex clothing or, in certain cases, to the garme...
    • 5 Jenama Foundation Terbaik, Beli Di Farmasi Je!
      Beberapa minggu sudah, penulis pernah mencadangkan beberapa jenama maskara terbaik yang mudah didapati pada harga berpatutan dari farmas...

    nuffnang ads

    Search This Blog

    Pages

    • Home

    About Me

    Unknown
    View my complete profile

    Blog Archive

    • ▼  2018 (371)
      • ▼  June (17)
        • ▼  Jun 22 (8)
          • Advantages and Disadvantages of Fasting for Runners
          • Refeeding Syndrome After Fasting
          • The Body's Reactions to Fasting
          • What Does Fasting Do to Your System?
          • Heartburn & Fat After Fasting
          • Urban forest research in the Mediterranean: A syst...
          • Assessment of ecotourism potential of urban forest...
          • THE POTENTIAL OF URBAN FOREST PARK FOR SUSTAINABLE...
        • ►  Jun 12 (1)
        • ►  Jun 11 (2)
        • ►  Jun 05 (6)
      • ►  May (6)
        • ►  May 31 (6)
      • ►  April (75)
        • ►  Apr 30 (1)
        • ►  Apr 27 (1)
        • ►  Apr 26 (15)
        • ►  Apr 25 (10)
        • ►  Apr 24 (11)
        • ►  Apr 18 (2)
        • ►  Apr 12 (4)
        • ►  Apr 10 (5)
        • ►  Apr 09 (9)
        • ►  Apr 05 (17)
      • ►  March (65)
        • ►  Mar 27 (7)
        • ►  Mar 22 (2)
        • ►  Mar 20 (4)
        • ►  Mar 13 (14)
        • ►  Mar 12 (11)
        • ►  Mar 08 (7)
        • ►  Mar 06 (1)
        • ►  Mar 05 (1)
        • ►  Mar 01 (18)
      • ►  February (103)
        • ►  Feb 28 (25)
        • ►  Feb 27 (27)
        • ►  Feb 26 (10)
        • ►  Feb 20 (1)
        • ►  Feb 19 (9)
        • ►  Feb 09 (13)
        • ►  Feb 06 (6)
        • ►  Feb 05 (5)
        • ►  Feb 02 (7)
      • ►  January (105)
        • ►  Jan 25 (11)
        • ►  Jan 23 (5)
        • ►  Jan 16 (6)
        • ►  Jan 15 (9)
        • ►  Jan 14 (7)
        • ►  Jan 10 (1)
        • ►  Jan 09 (2)
        • ►  Jan 08 (4)
        • ►  Jan 04 (24)
        • ►  Jan 03 (2)
        • ►  Jan 02 (21)
        • ►  Jan 01 (13)
    • ►  2017 (6160)
      • ►  December (11)
        • ►  Dec 30 (11)
      • ►  November (31)
        • ►  Nov 26 (9)
        • ►  Nov 07 (8)
        • ►  Nov 06 (3)
        • ►  Nov 01 (11)
      • ►  October (345)
        • ►  Oct 31 (4)
        • ►  Oct 25 (42)
        • ►  Oct 24 (5)
        • ►  Oct 23 (15)
        • ►  Oct 22 (3)
        • ►  Oct 18 (7)
        • ►  Oct 17 (27)
        • ►  Oct 16 (14)
        • ►  Oct 15 (6)
        • ►  Oct 13 (18)
        • ►  Oct 12 (44)
        • ►  Oct 11 (57)
        • ►  Oct 09 (47)
        • ►  Oct 06 (14)
        • ►  Oct 05 (1)
        • ►  Oct 04 (13)
        • ►  Oct 03 (17)
        • ►  Oct 02 (11)
      • ►  September (186)
        • ►  Sept 29 (3)
        • ►  Sept 26 (7)
        • ►  Sept 25 (18)
        • ►  Sept 21 (29)
        • ►  Sept 20 (10)
        • ►  Sept 19 (11)
        • ►  Sept 18 (2)
        • ►  Sept 14 (19)
        • ►  Sept 13 (28)
        • ►  Sept 11 (3)
        • ►  Sept 10 (15)
        • ►  Sept 08 (5)
        • ►  Sept 06 (22)
        • ►  Sept 05 (14)
      • ►  August (158)
        • ►  Aug 29 (10)
        • ►  Aug 28 (73)
        • ►  Aug 27 (2)
        • ►  Aug 21 (4)
        • ►  Aug 18 (17)
        • ►  Aug 17 (4)
        • ►  Aug 14 (13)
        • ►  Aug 11 (5)
        • ►  Aug 10 (4)
        • ►  Aug 09 (7)
        • ►  Aug 08 (1)
        • ►  Aug 06 (3)
        • ►  Aug 04 (2)
        • ►  Aug 03 (13)
      • ►  July (290)
        • ►  Jul 26 (9)
        • ►  Jul 25 (7)
        • ►  Jul 24 (25)
        • ►  Jul 23 (5)
        • ►  Jul 21 (13)
        • ►  Jul 18 (19)
        • ►  Jul 17 (18)
        • ►  Jul 14 (17)
        • ►  Jul 13 (75)
        • ►  Jul 12 (10)
        • ►  Jul 11 (64)
        • ►  Jul 10 (26)
        • ►  Jul 09 (2)
      • ►  June (522)
        • ►  Jun 30 (1)
        • ►  Jun 27 (3)
        • ►  Jun 22 (13)
        • ►  Jun 21 (41)
        • ►  Jun 20 (3)
        • ►  Jun 19 (68)
        • ►  Jun 16 (33)
        • ►  Jun 15 (87)
        • ►  Jun 13 (25)
        • ►  Jun 12 (26)
        • ►  Jun 09 (20)
        • ►  Jun 08 (60)
        • ►  Jun 07 (54)
        • ►  Jun 06 (53)
        • ►  Jun 05 (35)
      • ►  May (684)
        • ►  May 31 (6)
        • ►  May 22 (3)
        • ►  May 21 (14)
        • ►  May 20 (12)
        • ►  May 19 (3)
        • ►  May 18 (26)
        • ►  May 17 (63)
        • ►  May 16 (27)
        • ►  May 15 (25)
        • ►  May 14 (16)
        • ►  May 07 (9)
        • ►  May 06 (26)
        • ►  May 05 (74)
        • ►  May 04 (126)
        • ►  May 03 (51)
        • ►  May 02 (153)
        • ►  May 01 (50)
      • ►  April (759)
        • ►  Apr 29 (56)
        • ►  Apr 28 (37)
        • ►  Apr 27 (67)
        • ►  Apr 26 (87)
        • ►  Apr 25 (6)
        • ►  Apr 10 (4)
        • ►  Apr 09 (5)
        • ►  Apr 08 (78)
        • ►  Apr 07 (57)
        • ►  Apr 06 (52)
        • ►  Apr 05 (53)
        • ►  Apr 04 (43)
        • ►  Apr 03 (94)
        • ►  Apr 02 (28)
        • ►  Apr 01 (92)
      • ►  March (1744)
        • ►  Mar 31 (90)
        • ►  Mar 30 (74)
        • ►  Mar 29 (58)
        • ►  Mar 28 (50)
        • ►  Mar 27 (95)
        • ►  Mar 26 (58)
        • ►  Mar 25 (98)
        • ►  Mar 24 (94)
        • ►  Mar 23 (77)
        • ►  Mar 22 (43)
        • ►  Mar 21 (54)
        • ►  Mar 20 (43)
        • ►  Mar 19 (88)
        • ►  Mar 18 (65)
        • ►  Mar 17 (63)
        • ►  Mar 16 (94)
        • ►  Mar 15 (79)
        • ►  Mar 14 (35)
        • ►  Mar 11 (10)
        • ►  Mar 10 (43)
        • ►  Mar 09 (40)
        • ►  Mar 08 (27)
        • ►  Mar 07 (40)
        • ►  Mar 06 (62)
        • ►  Mar 05 (48)
        • ►  Mar 04 (63)
        • ►  Mar 03 (54)
        • ►  Mar 02 (13)
        • ►  Mar 01 (86)
      • ►  February (715)
        • ►  Feb 28 (10)
        • ►  Feb 27 (61)
        • ►  Feb 26 (31)
        • ►  Feb 24 (22)
        • ►  Feb 23 (31)
        • ►  Feb 22 (42)
        • ►  Feb 21 (30)
        • ►  Feb 20 (42)
        • ►  Feb 19 (43)
        • ►  Feb 18 (46)
        • ►  Feb 17 (39)
        • ►  Feb 16 (39)
        • ►  Feb 15 (24)
        • ►  Feb 14 (54)
        • ►  Feb 13 (25)
        • ►  Feb 12 (78)
        • ►  Feb 10 (53)
        • ►  Feb 09 (22)
        • ►  Feb 01 (23)
      • ►  January (715)
        • ►  Jan 30 (25)
        • ►  Jan 28 (19)
        • ►  Jan 27 (36)
        • ►  Jan 26 (27)
        • ►  Jan 24 (27)
        • ►  Jan 22 (22)
        • ►  Jan 21 (58)
        • ►  Jan 20 (20)
        • ►  Jan 19 (30)
        • ►  Jan 18 (39)
        • ►  Jan 17 (26)
        • ►  Jan 16 (36)
        • ►  Jan 15 (62)
        • ►  Jan 14 (22)
        • ►  Jan 13 (20)
        • ►  Jan 12 (33)
        • ►  Jan 11 (32)
        • ►  Jan 10 (26)
        • ►  Jan 05 (11)
        • ►  Jan 04 (22)
        • ►  Jan 03 (35)
        • ►  Jan 02 (34)
        • ►  Jan 01 (53)
    • ►  2016 (6885)
      • ►  December (986)
        • ►  Dec 31 (12)
        • ►  Dec 30 (23)
        • ►  Dec 29 (15)
        • ►  Dec 28 (29)
        • ►  Dec 27 (32)
        • ►  Dec 26 (29)
        • ►  Dec 25 (39)
        • ►  Dec 24 (43)
        • ►  Dec 23 (29)
        • ►  Dec 22 (28)
        • ►  Dec 21 (46)
        • ►  Dec 20 (28)
        • ►  Dec 19 (36)
        • ►  Dec 18 (14)
        • ►  Dec 17 (24)
        • ►  Dec 16 (10)
        • ►  Dec 15 (43)
        • ►  Dec 14 (55)
        • ►  Dec 13 (38)
        • ►  Dec 12 (45)
        • ►  Dec 11 (26)
        • ►  Dec 10 (48)
        • ►  Dec 09 (34)
        • ►  Dec 08 (22)
        • ►  Dec 07 (29)
        • ►  Dec 06 (15)
        • ►  Dec 05 (45)
        • ►  Dec 04 (38)
        • ►  Dec 03 (41)
        • ►  Dec 02 (41)
        • ►  Dec 01 (29)
      • ►  November (600)
        • ►  Nov 30 (38)
        • ►  Nov 29 (36)
        • ►  Nov 28 (43)
        • ►  Nov 27 (22)
        • ►  Nov 26 (27)
        • ►  Nov 25 (39)
        • ►  Nov 24 (27)
        • ►  Nov 23 (37)
        • ►  Nov 22 (21)
        • ►  Nov 21 (32)
        • ►  Nov 20 (20)
        • ►  Nov 19 (31)
        • ►  Nov 18 (34)
        • ►  Nov 17 (29)
        • ►  Nov 16 (21)
        • ►  Nov 15 (33)
        • ►  Nov 14 (16)
        • ►  Nov 13 (3)
        • ►  Nov 12 (3)
        • ►  Nov 11 (1)
        • ►  Nov 09 (2)
        • ►  Nov 07 (14)
        • ►  Nov 04 (16)
        • ►  Nov 03 (17)
        • ►  Nov 02 (23)
        • ►  Nov 01 (15)
      • ►  October (374)
        • ►  Oct 31 (15)
        • ►  Oct 30 (2)
        • ►  Oct 29 (4)
        • ►  Oct 28 (25)
        • ►  Oct 27 (19)
        • ►  Oct 26 (16)
        • ►  Oct 25 (11)
        • ►  Oct 24 (14)
        • ►  Oct 23 (12)
        • ►  Oct 21 (14)
        • ►  Oct 20 (19)
        • ►  Oct 19 (21)
        • ►  Oct 18 (17)
        • ►  Oct 17 (15)
        • ►  Oct 16 (20)
        • ►  Oct 15 (12)
        • ►  Oct 14 (11)
        • ►  Oct 13 (21)
        • ►  Oct 12 (13)
        • ►  Oct 11 (6)
        • ►  Oct 10 (12)
        • ►  Oct 09 (17)
        • ►  Oct 08 (10)
        • ►  Oct 07 (11)
        • ►  Oct 06 (19)
        • ►  Oct 05 (13)
        • ►  Oct 03 (5)
      • ►  September (406)
        • ►  Sept 29 (6)
        • ►  Sept 28 (2)
        • ►  Sept 27 (12)
        • ►  Sept 16 (20)
        • ►  Sept 15 (34)
        • ►  Sept 14 (39)
        • ►  Sept 13 (32)
        • ►  Sept 12 (36)
        • ►  Sept 11 (18)
        • ►  Sept 10 (16)
        • ►  Sept 07 (6)
        • ►  Sept 06 (26)
        • ►  Sept 05 (14)
        • ►  Sept 04 (44)
        • ►  Sept 03 (17)
        • ►  Sept 02 (38)
        • ►  Sept 01 (46)
      • ►  August (777)
        • ►  Aug 31 (13)
        • ►  Aug 29 (22)
        • ►  Aug 28 (13)
        • ►  Aug 27 (26)
        • ►  Aug 26 (18)
        • ►  Aug 25 (14)
        • ►  Aug 24 (13)
        • ►  Aug 23 (22)
        • ►  Aug 22 (23)
        • ►  Aug 21 (20)
        • ►  Aug 20 (23)
        • ►  Aug 19 (13)
        • ►  Aug 18 (31)
        • ►  Aug 17 (36)
        • ►  Aug 16 (17)
        • ►  Aug 15 (33)
        • ►  Aug 14 (24)
        • ►  Aug 13 (28)
        • ►  Aug 12 (28)
        • ►  Aug 11 (28)
        • ►  Aug 10 (59)
        • ►  Aug 09 (33)
        • ►  Aug 08 (39)
        • ►  Aug 07 (23)
        • ►  Aug 06 (36)
        • ►  Aug 05 (23)
        • ►  Aug 04 (25)
        • ►  Aug 03 (17)
        • ►  Aug 02 (26)
        • ►  Aug 01 (51)
      • ►  July (890)
        • ►  Jul 31 (27)
        • ►  Jul 30 (31)
        • ►  Jul 29 (29)
        • ►  Jul 28 (40)
        • ►  Jul 27 (32)
        • ►  Jul 26 (16)
        • ►  Jul 25 (5)
        • ►  Jul 24 (45)
        • ►  Jul 23 (16)
        • ►  Jul 22 (42)
        • ►  Jul 21 (11)
        • ►  Jul 20 (41)
        • ►  Jul 19 (31)
        • ►  Jul 18 (35)
        • ►  Jul 17 (41)
        • ►  Jul 16 (21)
        • ►  Jul 15 (23)
        • ►  Jul 14 (38)
        • ►  Jul 13 (49)
        • ►  Jul 12 (42)
        • ►  Jul 11 (25)
        • ►  Jul 10 (48)
        • ►  Jul 09 (33)
        • ►  Jul 08 (38)
        • ►  Jul 07 (19)
        • ►  Jul 06 (10)
        • ►  Jul 05 (14)
        • ►  Jul 04 (13)
        • ►  Jul 03 (20)
        • ►  Jul 02 (26)
        • ►  Jul 01 (29)
      • ►  June (1003)
        • ►  Jun 30 (29)
        • ►  Jun 29 (43)
        • ►  Jun 28 (27)
        • ►  Jun 27 (33)
        • ►  Jun 26 (49)
        • ►  Jun 25 (30)
        • ►  Jun 24 (32)
        • ►  Jun 23 (42)
        • ►  Jun 22 (38)
        • ►  Jun 21 (20)
        • ►  Jun 20 (30)
        • ►  Jun 19 (37)
        • ►  Jun 18 (15)
        • ►  Jun 17 (12)
        • ►  Jun 16 (52)
        • ►  Jun 15 (59)
        • ►  Jun 14 (49)
        • ►  Jun 13 (38)
        • ►  Jun 12 (39)
        • ►  Jun 11 (44)
        • ►  Jun 10 (22)
        • ►  Jun 09 (34)
        • ►  Jun 08 (39)
        • ►  Jun 07 (28)
        • ►  Jun 06 (38)
        • ►  Jun 05 (19)
        • ►  Jun 04 (20)
        • ►  Jun 03 (27)
        • ►  Jun 02 (27)
        • ►  Jun 01 (31)
      • ►  May (648)
        • ►  May 31 (32)
        • ►  May 30 (48)
        • ►  May 29 (46)
        • ►  May 28 (43)
        • ►  May 27 (19)
        • ►  May 26 (37)
        • ►  May 25 (29)
        • ►  May 24 (22)
        • ►  May 23 (23)
        • ►  May 22 (18)
        • ►  May 21 (18)
        • ►  May 20 (22)
        • ►  May 19 (28)
        • ►  May 18 (12)
        • ►  May 17 (24)
        • ►  May 16 (9)
        • ►  May 15 (18)
        • ►  May 14 (13)
        • ►  May 13 (16)
        • ►  May 12 (6)
        • ►  May 11 (15)
        • ►  May 10 (15)
        • ►  May 09 (25)
        • ►  May 08 (14)
        • ►  May 07 (15)
        • ►  May 06 (10)
        • ►  May 04 (21)
        • ►  May 03 (22)
        • ►  May 02 (9)
        • ►  May 01 (19)
      • ►  April (490)
        • ►  Apr 30 (7)
        • ►  Apr 29 (21)
        • ►  Apr 28 (19)
        • ►  Apr 27 (15)
        • ►  Apr 26 (12)
        • ►  Apr 25 (19)
        • ►  Apr 24 (13)
        • ►  Apr 23 (24)
        • ►  Apr 22 (24)
        • ►  Apr 21 (22)
        • ►  Apr 20 (19)
        • ►  Apr 19 (46)
        • ►  Apr 18 (24)
        • ►  Apr 17 (15)
        • ►  Apr 16 (19)
        • ►  Apr 15 (8)
        • ►  Apr 14 (19)
        • ►  Apr 13 (22)
        • ►  Apr 12 (18)
        • ►  Apr 11 (11)
        • ►  Apr 10 (13)
        • ►  Apr 09 (12)
        • ►  Apr 08 (12)
        • ►  Apr 07 (15)
        • ►  Apr 06 (16)
        • ►  Apr 05 (10)
        • ►  Apr 04 (8)
        • ►  Apr 03 (15)
        • ►  Apr 01 (12)
      • ►  March (445)
        • ►  Mar 31 (7)
        • ►  Mar 30 (10)
        • ►  Mar 29 (17)
        • ►  Mar 28 (15)
        • ►  Mar 27 (8)
        • ►  Mar 26 (11)
        • ►  Mar 25 (10)
        • ►  Mar 24 (9)
        • ►  Mar 23 (13)
        • ►  Mar 22 (9)
        • ►  Mar 21 (13)
        • ►  Mar 20 (9)
        • ►  Mar 19 (15)
        • ►  Mar 18 (14)
        • ►  Mar 17 (11)
        • ►  Mar 16 (15)
        • ►  Mar 15 (23)
        • ►  Mar 14 (26)
        • ►  Mar 13 (20)
        • ►  Mar 12 (14)
        • ►  Mar 11 (18)
        • ►  Mar 10 (27)
        • ►  Mar 09 (18)
        • ►  Mar 08 (25)
        • ►  Mar 07 (11)
        • ►  Mar 06 (15)
        • ►  Mar 05 (18)
        • ►  Mar 04 (9)
        • ►  Mar 03 (14)
        • ►  Mar 02 (7)
        • ►  Mar 01 (14)
      • ►  February (258)
        • ►  Feb 29 (22)
        • ►  Feb 28 (14)
        • ►  Feb 27 (12)
        • ►  Feb 26 (4)
        • ►  Feb 25 (17)
        • ►  Feb 24 (16)
        • ►  Feb 23 (16)
        • ►  Feb 22 (8)
        • ►  Feb 21 (23)
        • ►  Feb 20 (6)
        • ►  Feb 19 (5)
        • ►  Feb 18 (3)
        • ►  Feb 17 (9)
        • ►  Feb 16 (17)
        • ►  Feb 15 (20)
        • ►  Feb 14 (10)
        • ►  Feb 13 (17)
        • ►  Feb 11 (3)
        • ►  Feb 10 (1)
        • ►  Feb 08 (2)
        • ►  Feb 07 (5)
        • ►  Feb 05 (2)
        • ►  Feb 04 (10)
        • ►  Feb 03 (7)
        • ►  Feb 02 (1)
        • ►  Feb 01 (8)
      • ►  January (8)
        • ►  Jan 30 (4)
        • ►  Jan 10 (4)
    • ►  2013 (23)
      • ►  February (18)
        • ►  Feb 07 (1)
        • ►  Feb 06 (2)
        • ►  Feb 05 (8)
        • ►  Feb 04 (5)
        • ►  Feb 02 (1)
        • ►  Feb 01 (1)
      • ►  January (5)
        • ►  Jan 31 (4)
        • ►  Jan 30 (1)

    Report Abuse

    Follower

    Translate

    Total Pageviews

    nuffnang ads

    Nuffnang Ads

    nuffnang ads

    Nuffnang Ads

    Picture Window theme. Theme images by sndrk. Powered by Blogger.