Everything About Wood

Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.

Blog List

Saturday, 9 July 2016

Identification of the varietal origin of processed loose-leaf tea based on analysis of a single leaf by SNP nanofluidic array

Published Date
Available online 31 March 2016, doi:10.1016/j.cj.2016.02.001
Open Access, Creative Commons license, Funding information
In Press, Corrected Proof — Note to users

Identification of the varietal origin of processed loose-leaf tea based on analysis of a single leaf by SNP nanofluidic array

  • Wanping Fang a,b
  • Lyndel W. Meinhardt b
  • Huawei Tan a
  • Lin Zhou a
  • Sue Mischke b
  • Xinghua Wangc
  • Dapeng Zhang b,,
  • aCollege of Horticulture, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China
  • bSustainable Perennial Crops Laboratory, USDA-ARS, 10300 Baltimore Avenue, Bldg. 001, Rm. 223, BARC-W, Beltsville, MD 20705, USA
  • cYunnan Pu'er Tea Seeds Propagation and Extension Unit, Pu'er 665000, Yunnan, China
Received 26 October 2015. Revised 4 February 2016. Accepted 15 March 2016. Available online 31 March 2016.

Abstract
Tea is an important cash crop, representing a $40 billion-a-year global market. Differentiation of the tea market has resulted in increasing demand for tea products that are sustainably and responsibly produced. Tea authentication is important because of growing concerns about fraud involving premium tea products. Analytical technologies are needed for protection and value enhancement of high-quality brands. For loose-leaf teas, the challenge is that the authentication needs to be established on the basis of a single leaf, so that the products can be traced back to the original varieties. A new generation of molecular markers offers an ideal solution for authentication of processed agricultural products. Using a nanofluidic array to identify variant SNP sequences, we tested genetic identities using DNA extracted from single leaves of 14 processed commercial tea products. Based on the profiles of 60 SNP markers, the genetic identity of each tea sample was unambiguously identified by multilocus matching and ordination analysis. Results for repeated samples of multiple tea leaves from the same products (using three independent DNA extractions) showed 100% concordance, showing that the nanofluidic system is a reliable platform for generating tea DNA fingerprints with high accuracy. The method worked well on green, oolong, and black teas, and can handle a large number of samples in a short period of time. It is robust and cost-effective, thus showing high potential for practical application in the value chain of the tea industry.

Abbreviations
  • IFC, integrated fluidic circuit
  • PCoA, principal coordinates analysis
  • PIC, polymorphism information content
  • PID, probability of identity
  • PID-sib, probability of identity among siblings
  • STA, specific target amplification
  • Keywords

    • Authentication
    • Camellia sinensis
    • Conservation
    • Food adulteration
    • Molecular markers

    1 Introduction

    The tea plant, Camellia sinensis (L.) O. Kuntze, is a perennial woody evergreen flowering species in the family Theaceae [1] and [2] that has been esteemed throughout history. The present consumption of tea is billions of cups daily, making it the world's most universal beverage other than water [3]. With an annual production of approximately 4.8 million tons [4], tea represents a $40 billion-a-year industry [5]. Although overall consumption is expected to increase only moderately, tea drinkers are likely to demand, and be willing to pay for, a higher-quality product [6]. Commercial tea products are classified into categories based on processing techniques: degree and manner of “fermentation” (enzymatic oxidization) of the leaves and buds. Common categories include white, green, yellow, oolong, black (also known as “red” in China), and dark (genuinely fermented black) Pu'er teas. The method of processing affects the attributes of tea, including content of caffeine and polyphenols and thereby antioxidant activity and flavor [7], [8], [9] and [10]. Within each category, tea processors use leaves of various C. sinensis varieties that often differ greatly in quality.
    The specialty tea market has been rapidly expanding on a global scale, resulting in higher revenues and profits for tea growers and the industry. Accurate identification of specific C. sinensis varieties is critically important for ensuring the authentication of premium tea products and maintenance of brand image. However, efficient methods for varietal authentication of specialty tea products, especially loose-leaf teas, have not yet been developed. Instrumental methods, such as near-infrared spectroscopy (NIR) have been widely applied for tea quality control [11], [12], [13], [14] and [15]. Using NIR diffuse reflectance spectroscopy coupled with pattern recognition techniques, Tan et al. [16] were able to differentiate varieties of tea leaves from different geographical areas with a high degree of confidence (96%). However, the analysis was based on chemical components such as polyphenols, theanine, caffeine, and volatile compounds, which are influenced by many factors including not only genetic makeup of the plant but also environmental conditions during growth, time of harvest, and postharvest factors [17]. Moreover, although chemical analysis can readily differentiate tea varieties, it is much more challenging to match a tested variety with a known one with a high degree of certainty. Positive identification requires more than just sensory or instrumental examination.
    The advantages of methods based on DNA to identify the botanical origin of food products, particularly after commercial processing, are well recognized [18] and [19]. Standard DNA barcodes have been used to discriminate between C. sinensis and most other herbal tea species, but were not specific enough to identify individuals within the species [20] and [21]. Methods using markers based on PCR amplification of a sequence-tagged or other region in a gene, and analysis of resulting restriction fragment length polymorphisms (RFLP, AFLP), have been used to identify tea varieties [22], [23], [24] and [25]. Hu et al. [26] used this method with markers from both cytoplasmic (mitochondrial and chloroplast) and nuclear tea genomes. Polymorphisms in amplification length of microsatellites or of coding and non-coding regions of specific genes have also been used for tea varietal identification [24], [27], [28], [29], [30] and [31]. However, to date, the application of DNA fingerprinting has been used only to differentiate varieties, rather than confirm the genetic identity of two samples. Moreover, even with the use of microsatellite markers, resolving genotyping results from different labs has not been straightforward. It is difficult to standardize data generated on different genotyping platforms, and comparison of data is further complicated because the same alleles may be binned differently. Even on the same platform, analysis can be complicated by common PCR artifacts such as stutter due to slipped-strand mispairing, which may lead to incorrect identification of an allele, and diminished amplification of longer repeats, which may lead to scoring heterozygotes as homozygous or other spurious genotypes [32] and [33]. To date, none of the markers have been applied to differentially processed tea products, which are fermented, baked, or sun-dried to different extents. In processed tea, DNA is of poor quality, highly degraded, and contains PCR inhibitors that can pose problems for target amplification. Such factors that interfere with the application of simple sequence repeat (SSR)-based fingerprints for tea authentication can lead to false conclusions.
    Single-nucleotide polymorphism (SNP) markers are the most abundant class of polymorphisms in plant genomes [34]. In contrast to SSR markers, accurate identification of SNPs can be performed without the requirement of DNA separation by size and can accordingly be automated in an assay array or microchip format. The biallelic nature of SNPs offers a much lower error rate in allele calling than that of SSRs, and genotyping can be multiplexed and accomplished quickly at a lower cost. Because of these advantages, SNPs have become the marker of choice for variety identification in plants [35] and [36]. Recently, Bazakos et al. [37] used SNP analysis to identify the varietal origin of olive oils. Development of SNP markers for the tea plant has been reported by a community of tea scientists [25], [38], [39] and [40]. However, application of SNP markers in genotype identification, as well as traceability and authentication of commercial tea products, has not been studied. In our previous report [41], we demonstrated the efficacy of using a nanofluidic system to generate SNP fingerprints of the tea plant. A total of 1786 putative SNPs were identified from a tea EST database, of which 96 SNPs were evaluated in 40 fresh leaf samples of Chinese tea varieties. The results showed that each of the tested varieties had a unique SNP profile that allowed unambiguous varietal identification. However, the efficacy of applying these SNP markers to processed, commercial tea products has yet to be systematically investigated.
    For loose-leaf teas, the challenge is that DNA fingerprints must be established on the basis of a single leaf, so that the products can be traced back to the original variety. This is because, during postharvest, tea leaves from different varieties may be mixed. Adulteration can happen at any step prior to sale to traders. Moreover, the effects of different fermentation levels in various loose-leaf tea products need to be examined for this SNP genotyping system. The objective of this work was to assess the efficacy of the previously reported tea SNP panel for varietal authentication in loose-leaf tea products, using DNA extracted from a single leaf of green, black, or oolong tea.

    2 Materials and methods

    2.1 Sample preparation

    Commercial tea products characterized in this study and their sources are listed in Table 1. A total of 14 loose-leaf tea products, including 10 green, two oolong, one black, and one raw Pu'er tea were used in this study (Table 1). All tea products were purchased from local markets. For each product, one to three single leaves were independently and randomly sampled from the same package.
    Table 1. List of 14 tea products, including 24 single leaf samples, and their origins.
    Code of single leaf samplesName of tea productTea typeOrigin
    1Bi Luo Chun (A)GreenZhejiang, China
    2Bi Luo Chun (B)GreenZhejiang, China
    3Bi Luo Chun (C )GreenZhejiang, China
    4Long Jing 1 (A)GreenZhejiang, China
    5Long Jing 1 (B)GreenZhejiang, China
    6Long Jing 1 (C )GreenZhejiang, China
    7Long Jing 2GreenZhejiang, China
    8Gua PianGreenAnhui, China
    9Dong Ping GaoshanGreenShandong, China
    10Laoshan GreenGreenShandong, China
    11Yu Hua ChaGreenJiangsu, China
    12SenchaGreenJapan
    13GenmaichaGreenJapan
    14Jasmine (A)GreenVietnam
    15Jasmine (B)GreenVietnam
    16Jasmine (C)GreenVietnam
    17Da Yu Ling oolongOolongTaiwan, China
    18Tung-Ting oolong (A)OolongTaiwan, China
    19Tung-Ting oolong (B)OolongTaiwan, China
    20Tung-Ting oolong (C)OolongTaiwan, China
    21Raw Pu'erRaw Pu'erYunnan, China
    22Assam (A)BlackIndia
    23Assam (B)BlackIndia
    24Assam (C )BlackIndia

    2.2 Extraction and preparation of DNA from single tea leaves

    DNA was extracted from each single leaf (or bud) using the DNeasy Plant Mini kit (Qiagen, Inc., Valencia, CA), which is based on the use of silica as an affinity matrix. A single leaf was placed in a 2-mL microcentrifuge tube with one 1/4-in. ceramic sphere and a 0.15 g garnet matrix (Lysing matrix A; MP Biomedicals, Solon, OH). The dry samples were disrupted by high-speed shaking in a TissueLyser II (Qiagen) at 30 Hz for 1 min, followed by an additional 1 min, with a 1 min rest between disruptions. Lysis solution (buffer AP1 containing 25 mg mL− 1 polyvinylpolypyrrolidone), along with RNase A (Ribonuclease I), was added to the powdered leaf tissue and the mixture was incubated at 65 °C, as specified in the kit instructions. The remainder of the extraction method followed the manufacturer's suggestions. DNA was eluted from the silica membrane with two washes with 50 μL AE buffer, which were pooled to make 100 μL of DNA solution. Using a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE), DNA concentration was determined by absorbance at 260 nm. DNA purity was estimated by the 260/280 ratio and the 260/230 ratio. Prior to SNP genotyping, each DNA was subjected to a multiplex Specific Target Amplification (STA) procedure using primer pools provided by Fluidigm Corp. (South San Francisco, CA) and Qiagen 2X Multiplex PCR Master Mix (PN 206143) according to the protocol recommended in the Fluidigm SNP Genotyping User Guide [42].

    2.3 SNP markers and genotyping

    The 60 tea SNP markers used for the SNPtype genotyping panel (Fluidigm Corp) were reported in our previous publication [41]. Genotyping was performed on the high-throughput Fluidigm EP1 system, using the Fluidigm SNPtype Genotyping Reagent Kit according to the manufacturer's instructions, and a nanofluidic 96.96 Dynamic Array IFC (Integrated Fluidic Circuit; Fluidigm Corp.). This chip automatically assembles PCR reactions, enabling simultaneous testing of up to 96 samples with 96 SNP markers. Fluorescence intensities were measured with the EP1 reader and results were plotted on two axes. Genotype-callings were made using the Fluidigm SNP Genotyping Analysis program.

    2.4 Data analysis

    Summary statistics for each SNP locus, including observed heterozygosity (Ho), gene diversity, and inbreeding coefficient, were computed for each locus separately as well as for all loci combined, using GenAlEx 6.5 [43] and [44].
    To evaluate the differentiation power of SNP markers on processed tea products, multilocus matching was used to compare the samples in the data set, and the same program was used for genotype matching. Samples that were completely matched at all polymorphic loci were considered duplicates derived from the same clone. To assess the differentiation power of the SNP panel, the probability of identity among siblings (PID-sib) [45] was computed, which was defined as the probability that two sibling individuals drawn at random from a population have the same multilocus genotype. The overall PID-sib is the upper limit of the possible ranges of PID in a population, thus providing the most conservative number of loci required to resolve all individuals, including relatives [45].
    To assess the relationships among the tested tea samples, we computed the genetic distances for each possible pair of tested individuals. The matrix of genetic distances was then visualized using principal coordinates analysis (PCoA), implemented in GenAlEx 6.2 [43] and [44]. As a complementary approach, the genetic relationship was further assessed by cluster analysis. Nei's genetic distance [46] was chosen as a distance measurement (n = 20). The computation was performed using Microsatellite Analyser [47]. A dendrogram was generated from the resulting distance matrix using the neighbor-joining method [48].

    3 Results

    3.1 DNA extraction

    DNA concentration ranged from 3.4 to 21.7 ng μL− 1 among the 14 tea products (represented by 24 DNA extractions), with an average of 10.02 ng μL− 1 per single leaf sample. The average ratio of absorbance at 260 nm and 280 nm by NanoDrop measurement was 1.62 among the 14 varieties. The lowest was found for raw Pu'er tea (1.06) and the highest for Laoshan Green (2.08). The 260/230 absorbance ratios were 0.20 to 1.01, with an average of 0.86 among the 14 tea products (Table 2).
    Table 2. Concentration and quality of DNA samples extracted from a single leaf/bud in 14 loose-leaf tea products.
    Name of productTypeConcentration (ng μL− 1)Quality
    A260/280A260/230
    Bi Luo Chun1)Green9.061.580.95
    Long Jing (1)1)Green12.431.770.87
    Long Jing (2)Green10.581.451.01
    Gua PianGreen11.331.530.89
    Dong Ping GaoshanGreen12.571.540.95
    Laoshan GreenGreen16.362.080.93
    Yu Hua ChaGreen9.591.580.85
    SenchaGreen15.671.751.00
    GenmaichaGreen3.401.800.88
    Jasmine1)Green10.621.580.96
    Da Yu Ling oolongOolong10.551.660.20
    Tung-Ting oolong1)Oolong10.701.760.79
    Pu'er (raw)Pu'er (raw)21.701.060.88
    Assam1)Black11.781.550.87
    Mean11.881.620.86
    • 1
      Averaged over three leaf samples.

    3.2 Summary information of SNP fingerprints and multilocus matching of SNP fingerprints among tested samples

    All 60 polymorphic SNPs were reliably scored across the 24 single leaf tea samples, unambiguously differentiating all 14 loose-leaf tea products. The reliability of the 60 SNPs was demonstrated by repeated sampling of multiple leaves from the same tea products (Table 3). Individual genotype matching (pairwise comparisons) revealed fully matched trios among these samples, with identical SNP profiles (across all 60 loci) observed for replicate samples of Long Jing 1 and Tung-Ting oolong (Table 3). PID-sib, calculated from the 24 samples under investigation, predicted that the probability of two unrelated samples having the same genotype at all 60 SNP loci was approximately 1 in 100,000. The result also showed that the multiple leaves of these varieties had indeed been sampled from the same clone. In contrast, the other three varieties in Table 3 showed different SNP profiles among multiple leaf samples, indicating that these leaves had been harvested from different tea trees, possibly from seed progenies in which each tree was genetically different. This was the case for Bi Luo Chun from China, Assam from India, and Jasmine from Vietnam.
    Table 3. Examples of SNP fingerprints based on single leaves for five green, black, and oolong tea products. The table shows only 22 of the full array of 60 SNPs.
    Sample nameCs1Cs3Cs11Cs12Cs14Cs16Cs17Cs18Cs19Cs21Cs23Cs25Cs26Cs28Cs30Cs33Cs36Cs39Cs41Cs44Cs47Cs52
    Tung-Ting oolong (A)CTTTCTTTAACATTCTCCAGTTCCACTTGGCCGTAAAACTAAGT
    Tung-Ting oolong (B)CTTTCTTTAACATTCTCCAGTTCCACTTGGCCGTAAAACTAAGT
    Tung-Ting oolong (C)CTTTCTTTAACATTCTCCAGTTCCACTTGGCCGTAAAACTAAGT
    Long Jing 1 (A)CCCTCTTTTTCCGTCTCCAGCTTTCCAAAGCCGTCCAATTAGGT
    Long Jing 1 (B)CCCTCTTTTTCCGTCTCCAGCTTTCCAAAGCCGTCCAATTAGGT
    Long Jing 1 (C)CCCTCTTTTTCCGTCTCCAGCTTTCCAAAGCCGTCCAATTAGGT
    Bi Luo Chun (A)CCCTTTTTATCCGGCCCCAGTTCTACTTGGCCGTCCAATTAAGG
    Bi Luo Chun (B)CTTTTTTTATCCGGCCCCAGTTCCACTTGGCCGTCCCACTAGGG
    Bi Luo Chun (C)CTTTTTTTTTCCGGCTCTAGTTCCACTAAGTTGTAACATTAAGG
    Jasmine (A)CTCTCCCCATCCTTCTCTAATTTTAATTAGCCGTCCAACCAAGT
    Jasmine (B)TTTTCCCCATCCGTCCCTAATTCTAATTGGCCGTCCAACTAAGT
    Jasmine (C)CTCTCCCCATCCGTCTCCAATTTTAAAAGGCCGTCCAACTAAGG
    After removal of duplicated samples, the 20 samples with unique SNP profiles were used to compute summary information of allele frequency using GenAlex 6.5. The mean value of Shannon's information index was 0.512, ranging from 0.115 to 0.693. The mean observed heterozygosity was 0.401, ranging from 0.05 to 0.95, whereas the mean expected heterozygosity was 0.341, ranging from 0.05 to 0.49 (Table 4). The result is comparable with previously reported results [41] for these SNP markers, where high values of observed heterozygosity (Ho = 0.701), gene diversity (He = 0.651), and information index value (I = 0.604) were found across the same 60 SNP loci in 40 Chinese tea varieties.
    Table 4. Shannon's information index, heterozygosity, and inbreeding coefficient of the 60 SNP loci, scored on 14 loose-leaf tea products.
    CategoryShannon's information indexObserved heterozygosityExpected heterozygosityInbreeding coefficient
    Range0.115–0.6930.05–0.950.05–0.49− 1.667
    Mean0.5120.4010.341− 0.123
    SE0.0220.0330.0180.053

    3.3 Genetic relationship among tested tea samples

    The genetic distances among the tea samples are presented in Table 5. The smallest pairwise distance (D = 20) was between two samples from the Chinese green tea Bi Luo Chun, whereas the largest genetic distance (D = 64) was between the Chinese green tea Dong Ping Gaoshan and Assam B from India. The genetic relationships among the tested samples were shown by PCoA (Fig. 1). The first three main PCO axes accounted for 26.1%, 17.4%, and 13.4% of total variation, respectively. In the plane of coordinate 1 vs. 2 (Fig. 1), there is an apparent pattern of clustering among the 20 samples. It appeared that the tea products from India and Vietnam, including the green tea Jasmine and the black tea Assam, were at a distance from the tea products from mainland China, Taiwan of China, and Japan. The Japanese tea Genmaicha was closely affiliated with the tea products from Zhejiang and Anhui, eastern China. The two oolong teas from Taiwan of China (Tung-Ting oolong and Da Yu Ling oolong) were very similar to each other, but showed substantial differences from other Chinese teas. The raw Pu'er and the green tea Bi Luo Chun (B) fell between the India/Vietnam and the China/Japan clusters.
    Table 5. Matrix of genetic distances among 20 single-leaf tea samples (representing 14 tea products), based on the profiles with SNP markers.
    Sample No.Sample name1234567891011121314151617181920
    1Pu'er0
    2Bi Luo Chun (A)200
    3Bi Luo Chun (B)22320
    4Bi Luo Chun (C)3638400
    5Yu Hua465052500
    6Gua Pian37414545390
    7Lao Shan Green3226362648350
    8Dong Ping Gaoshan393949475946310
    9Long Jing 128244438404130570
    10Long Jing 22719333747362940290
    11Sen Cha454151414752335035360
    12Gemaicha42445036564934514633390
    13Da Yu Ling oolong3133353753383332492852430
    14Tung-Ting oolong27313535533227284532504180
    15Assam (A)43574945475047585148484952480
    16Assam (B)4555494161525764595056615048340
    17Assam (C)354737454146455847384655404024300
    18Jasmine (A)32464656565556594251516045434949410
    19Jasmine (B)3147354761464764514856534236424628250
    20Jasmine (C)294543476354456041505651464044484221220
    Fig. 1. PCoA plot of 14 loose-leaf tea products represented by 20 single leaf samples. Identification of accessions corresponds to samples listed in Table 1. Only one sample each from Long Jing 1 and Tung-Ting oolong was retained in the clustering analysis, after verification of sample homogeneity. The plane of the first three main PCO axes accounted for 56.9% of total variation. The first axis represents 26.1% of total information, the second 17.4%, and the third 13.4%.
    A neighbor-joining dendrogram based on Nei's distance provided a complementary supporting view of the 20 samples, revealing a pattern of relationships consistent with those revealed in the PCoA (Fig. 1). The NJ tree showed that the 20 samples can be grouped into two main clusters (Fig. 2). The first cluster comprised all three Jasmine tea samples from Vietnam and all three Assam tea samples. The second cluster included all the green, raw Pu'er, and oolong teas from mainland China, Japan, and Taiwan of China. The two Long Jing tea products (Long Jing 1 and Long Jing 2) were grouped in different subclusters, indicating that different varieties were used to produce the same brand of products. The same case was observed in green tea Bi Luo Chun, where the three individual leaf samples were grouped in three different subclusters, revealing a mixture of different varieties in the tea package.
    Fig. 2. Neighbor-joining dendrogram depicting the relationships among 14 tea products represented by 20 single leaf samples. Identification of accessions corresponds to samples listed in Table 1. Only one sample each from Long Jing 1 and Tung-Ting oolong was retained in the clustering analysis, after verification of sample homogeneity.

    4 Discussion

    Loose-leaf tea comprises the bulk of the specialty tea market. Green tea alone accounts for approximately one million metric tons of global tea production [49]. To date, it has not been possible to discern the unambiguous genetic identity of a tea variety by morphological and biochemical characteristics, especially for processed tea. Owing to insufficient throughput, accuracy, and data standardization, existing molecular marker-based technologies such as SSR marker fingerprinting, are of limited use. Furthermore, processed tea leaf in commercial products usually contain high levels of polyphenolic and other PCR-inhibitory compounds and there can also be residue from microorganisms resulting from the fermentation and drying processes. Because of these problems, a robust analytical system is needed for genotyping tea DNA.
    In the present study, we demonstrated a DNA fingerprinting method that uses a small set of SNP markers to verify the genetic identity of a processed single tea leaf. Our results showed that a nanofluidic array of SNP markers is particularly suitable for this purpose. The specific target amplification protocol [50] efficiently addressed potential problems of quality and/or quantity of DNA extracted from a single processed tea leaf. This protocol, performed before genotyping, is a multiplex PCR reaction that uses primers for all loci of interest, but without targeting the specific alleles, thus proportionally increasing the amplified copies of these loci. This procedure solved our problem of recovery of low DNA concentration from processed commercial tea leaves. Results for repeated samples of multiple tea leaves from the same products (using three independent DNA extractions) showed 100% concordance, suggesting that the nanofluidic system is a reliable platform for generating tea DNA fingerprints with high accuracy. The method worked well on green tea, which is not fermented, for moderately fermented oolong tea, and for deeply fermented black tea. This method can handle a large number of samples in a short period of time and the results are highly robust and repeatable.
    The effectiveness of individual identification via SNP fingerprints depends on the number of loci used for genotyping. An important statistical parameter for determining the number of loci required to identify all distinct individuals with the needed confidence level is the probability of identity (PID). Multilocus PID values can be obtained by multiplying together single-locus PID values, assuming independence of loci. A stringent PID value is needed for domesticated crop species because they often share similar ancestors. Thus, a PID calculated for sibs would provide a highly conservative threshold for a domesticated crop species. The present results show that using the 60 SNP loci, the chance of sampling identical genotypes from a random mating population would be 1 of 100,000. It thus predicts the high statistical power of using this set of SNPs for tea genotype verification. Given that tea is an outcrossing species, each tea tree derived from seed is expected to have a unique genotype. The present result shows that the multiple samples of Bi Luo Chun, Jasmine, and Assam had different genotypes, suggesting that these tea leaves were sampled from a population of trees propagated by seed. For such tea plants, varietal authentication would need to be performed at the population level and a tested tea sample would need to be compared with the SNP profile of the reference seed population. Statistical approaches such as assignment test, which assigns an unknown sample to a given population based on multilocus DNA marker profiles, may need to be employed. Using this approach, Fang et al. [51] were able to test the varietal authenticity of fine-flavored cocoa beans. The same principle can be applied to tea authentication. In recent years, clone propagation has been widely promoted as a means of improving the consistency of tea quality [52]. Both Long Jing 1 from Zhejiang and Tung-Ting oolong from Taiwan are well-known premium loose teas that command a high price in the specialty tea market, and the results of this study confirm that they were sampled from clonal trees. For clonally propagated varieties, authentication through SNP fingerprinting is straightforward. Varietal authentication can be achieved by comparing any processed tea samples labeled as Long Jing with the reference Long Jing clone.
    The result of multivariate analysis by PCoA revealed diversity within tea types and a significant difference between Assam-type and China-type teas. This result is consistent with previously reported studies based on AFLP [23], SSR [27], [53] and [54], and CAP markers [26]. It thus further supports the classification of C. sinensisinto different varieties including C. sinensis var. assamica (“Assam”) and C. sinensisvar. sinensis [2], [55], [56] and [57]. The Vietnamese Jasmine tea was found to be grouped together with the Assam type. This finding is consistent with Vo's finding [58]that some promising tea clones in Vietnam (such as clone PH1) were selected from the Assam germplasm. It also supports the finding of Wachira et al. [59] that grouped tea varieties from the Indochina peninsula together with those from India. The close proximity of Japanese Genmaicha and Sencha teas with the Chinese varieties supports the notion that Japanese tea was introduced from China. The Taiwanese Tung-Ting oolong tea occupies a distinct position in the PCoA plot, suggesting that its genetic background is substantially different from those from Zhejiang and Jiangsu in mainland China. In our previous study we showed that the tea landraces from Zhejiang and Jiangsu had different genetic backgrounds from those from Fujian Province in China. However, given that no Fujian tea was included in the present study, we cannot determine whether the Tung-Ting oolong was from native Taiwanese tea or was based on introduced Fujian tea germplasm. The present study serves as a proof of principle that a robust SNP profile can be established based on a single leaf (or bud) of commercial tea products. However, for practical application of this protocol in the value chain of the tea industry, a much larger number of samples will need to be analyzed for each tea product or variety, in order to address the issue of intra-varietal variation. More loose-leaf tea products are being tested in our laboratory using this protocol. Our goal is to establish a comprehensive database so that reference SNP profiles can be found for each tea variety.
    In conclusion, we conducted a pilot study of varietal authentication for loose tea. Our main objective was to show that varietal authentication of tea can be achieved by genotyping a single leaf of a processed tea product, irrespective of fermentation method. We showed that use of a nanofluidic array with the small set of tea SNP markers was efficient and reliable for varietal verification. This technology enabled us to generate high-quality SNP profiles based on DNA extracted from processed tea products, including green, oolong, and black teas. To our knowledge, this is the first authentication study of commercial tea products using SNP molecular markers. The approach is sufficiently robust for verification of authenticity of specialty tea varieties and thus has high potential for practical application in the tea value chain.

    Acknowledgements

    We thank Stephen Pinney of USDA-ARS, Sustainable Perennial Crops Laboratory, for technical support in SNP genotyping. References by the USDA to a company and/or product are only for the purposes of information and do not imply approval or recommendation of the product to the exclusion of others that may also be suitable.

    References

      • [1]
      • P.K. Barua
      • Classification of the Tea Plant, Two and a Bud, Volume 10, 1963, pp. 3–11
      • View Record in Scopus
        Citing articles (11)
      • [2]
      • T.L. Ming, B. Bartholomew
      • Theaceae
      • Flora of China, Z.Y. Wu, P.H. Raven, D.Y. Hong, 2007, Science Press & Missouri Botanical Garden Press, Beijing & St, Louis, pp. 367–412
      • [3]
      • A. MacFarlane, I. MacFarlane
      • The Empire of Tea: The Remarkable History of the Plant that Took Over the World
      • 2004, The Overlook Press, New York
      • [4]
      • FAO, FAOSTAT Database. Food and Agriculture Organization of the United Nations. (http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor, on 2015-2-12)
      • [5]
      • World Tea News Market Report. Issue 4. http://www.worldteanews.com/wp-content/uploads/Final-October-Market-Report.pdf, (2015–02-09).
      • [6]
      • J. Clay
      • World Agriculture and the Environment: A Commodity-by-Commodity Guide to Impacts and Practices
      • 2004, Island Press, Washington, DC
      • [7]
      • P. Carloni, L. Tiano, L. Padella, T. Bacchetti, C. Customu, A. Kay, E. Damiani
      • Antioxidant activity of white, green and black tea obtained from the same tea cultivar
      • Food Res. Int., Volume 53, 2013, pp. 900–908
      • Article
         | 
         PDF (1014 K)
         | 
        View Record in Scopus
        Citing articles (24)
      • [8]
      • M.J. Kim, K.M. Maria John, J.N. Choi, S. Lee, A.J. Kim, Y.M. Kim, C.H. Lee
      • Changes in secondary metabolites of green tea during fermentation by Aspergillus oryzae and its effect on antioxidant potential
      • Food Res. Int., Volume 53, 2013, pp. 670–677
      • Article
         | 
         PDF (910 K)
         | 
        View Record in Scopus
        Citing articles (10)
      • [9]
      • A.B. Sharangi
      • Medicinal and therapeutic potentialities of tea (Camellia sinensis L.)—a review
      • Food Res. Int., Volume 42, 2009, pp. 529–535
      • Article
         | 
         PDF (179 K)
         | 
        View Record in Scopus
        Citing articles (139)
      • [10]
      • L. Zhang, Z.Z. Zhang, Y.B. Zhou, T.J. Ling, X.C. Wan
      • Chinese dark teas: postfermentation, chemistry and biological activities
      • Food Res. Int., Volume 53, 2013, pp. 600–607
      • Article
         | 
         PDF (453 K)
         | 
        View Record in Scopus
        Citing articles (13)
      • [11]
      • Q.S. Chen, J.W. Zhao, X.Y. Huang, H.D. Zhang, M.H. Liu
      • Simultaneous determination of total polyphenols and caffeine contents of green tea by near-infrared reflectance spectroscopy
      • Microchem. J., Volume 83, 2006, pp. 42–47
      • Article
         | 
         PDF (258 K)
         | 
        View Record in Scopus
        Citing articles (62)
      • [12]
      • Q.S. Chen, J.W. Zhao, M.H. Liu, J.R. Cai, J.H. Liu
      • Determination of total polyphenols content in green tea using FT-NIR spectroscopy and different PLS algorithms
      • J. Pharm. Biomed. Anal., Volume 46, 2008, pp. 568–573
      • Article
         | 
         PDF (559 K)
         | 
        View Record in Scopus
        Citing articles (137)
      • [13]
      • Y. He, X.L. Li, X.F. Deng
      • Discrimination of varieties of tea using near infrared spectroscopy by principal component analysis and BP model
      • J. Food Eng., Volume 79, 2007, pp. 1238–1242
      • Article
         | 
         PDF (503 K)
         | 
        View Record in Scopus
        Citing articles (126)
      • [14]
      • J. Luypaert, M.H. Zhang, D.L. Massart
      • Feasibility study for the use of near infrared spectroscopy in the qualitative and quantitative analysis of green tea, Camellia sinensis (L.)
      • Anal. Chim. Acta, Volume 478, 2003, pp. 303–312
      • Article
         | 
         PDF (204 K)
         | 
        View Record in Scopus
        Citing articles (123)
      • [15]
      • H. Schulz, U.H. Engelhardt, A. Wegent, H.H. Drews, S. Lapczynski
      • Application of near-infrared reflectance spectroscopy to the simultaneous prediction of alkaloids and phenolic substances in green tea leaves
      • J. Agric. Food Chem., Volume 47, 1999, pp. 5064–5067
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (105)
      • [16]
      • S.M. Tan, R.M. Luo, Y.P. Zhou, H. Gong, Z. Tan
      • Rapid and non-destructive discrimination of tea varieties by near infrared diffuse reflection spectroscopy coupled with classification and regression trees
      • Afr. J. Biotechnol., Volume 11, 2012, pp. 2303–2312
      • View Record in Scopus
        Citing articles (1)
      • [17]
      • J.E. Lee, B.J. Lee, J.O. Chung, J.A. Hwant, S.J. Lee, C.H. Lee, Y.S. Hong
      • Geographical and climatic dependencies of green tea (Camellia sinensis) metabolites: a 1H NMR-based metabolomics study
      • J. Agric. Food Chem., Volume 58, 2010, pp. 10582–10589
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (52)
      • [18]
      • P. Madesis, I. Ganopoulos, I. Sakaridis, A. Argiriou, A. Tsaftaris
      • Advances of DNA-based methods for tracing the botanical origin of food products
      • Food Res. Int., Volume 60, 2014, pp. 163–172
      • Article
         | 
         PDF (530 K)
         | 
        View Record in Scopus
        Citing articles (18)
      • [19]
      • S. Ni, M.Z. Yao, L. Chen, L.P. Zhao, X.C. Wang
      • Germplasm and breeding research of tea plant based on DNA marker approaches
      • Front. Agric. Chin., Volume 2, 2008, pp. 200–207
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (6)
      • [20]
      • S. Longhi, L. Giongo, M. Buti, N. Surbanovski, R. Viola, R. Velasco, J.A. Ward, D.J. Sargent
      • Molecular genetics and genomics of the Rosoideae: state of the art and future perspectives
      • Hortic. Res., Volume 1, 2014, pp. 1–18
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (6)
      • [21]
      • M.Y. Stoeckle, C.C. Gamble, R. Kirpekar, G. Young, S. Ahmed, D.P. Little
      • Commercial teas highlight plant DNA barcode identification successes and obstacles
      • Sci. Rep., Volume 1, 2011, pp. 42–49
      • View Record in Scopus
        Citing articles (2)
      • [22]
      • S.S. Kaundun, S. Matsumoto
      • Identification of processed Japanese green tea based on polymorphisms generated by STS-RFLP analysis
      • J. Agric. Food Chem., Volume 51, 2003, pp. 1765–1770
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (25)
      • [23]
      • R.K. Sharma, M.S. Negi, S. Sharma, P. Bhardwaj, R. Kumar, E. Bhattachrya, S.B. Tripathi, D. Vijayan, A.R. Baruah, S.C. Das, B. Bera, R. Rajkumar, J. Thomas, R.K. Sud, N. Muraleedharan, M. Hazarika, M. Lakshmikumaran, S.N. Raina, P.S. Ahuja
      • AFLP-based genetic diversity assessment of commercially important tea germplasm in India
      • Biochem. Genet., Volume 48, 2010, pp. 549–564
      • View Record in Scopus
        Citing articles (11)
      • [24]
      • T. Ujihara, S. Matsumoto, N. Hayashi, K. Kohata
      • Cultivar identification and analysis of the blended ratio of green tea production on the market using DNA markers
      • Food Sci. Technol. Res., Volume 11, 2005, pp. 43–45
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (8)
      • [25]
      • T. Ujihara, F. Taniguchi, J. Tanaka, N. Hayashi
      • Development of expressed sequence tag (EST)-based cleaved amplified polymorphic sequence (CAPS) markers of tea plant and their application to cultivar identification
      • J. Agric. Food Chem., Volume 59, 2011, pp. 1557–1564
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (4)
      • [26]
      • C.Y. Hu, Y.Z. Tsai, S.F. Lin
      • Development of STS and CAPS markers for variety identification and genetic diversity analysis of tea germplasm in Taiwan
      • Bot. Stud., Volume 55, 2014, pp. 12–27
      • Full Text via CrossRef
      • [27]
      • W.P. Fang, H. Cheng, Y. Duan, X. Jiang, X. Li
      • Genetic diversity and relationship of clonal tea (Camellia sinensis) cultivars in China as revealed by SSR markers
      • Plant Syst. Evol., Volume 298, 2012, pp. 469–483
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (11)
      • [28]
      • S.S. Kaundun, S. Matsumoto
      • PCR-based amplicon length polymorphisms (ALPs) at microsatellite loci and indels from non-coding DNA regions of cloned genes as a means of authenticating commercial Japanese green teas
      • J. Sci. Food Agric., Volume 84, 2004, pp. 895–902
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (11)
      • [29]
      • F. Taniguchi, K. Kimura, T. Saba, A. Ogino, S. Yamaguchi, J. Tanaka
      • Worldwide core collections of tea (Camellia sinensis) based on SSR markers
      • Tree Genet. Genomes, Volume 10, 2014, pp. 1555–1565
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (7)
      • [30]
      • R.K. Sharma, P. Bhardwaj, R. Negi, T. Mohapatra, P.S. Ahuja
      • Identification, characterization and utilization of unigene derived microsatellite markers in tea (Camellia sinensis L.)
      • BMC Plant Biol., Volume 9, 2009, pp. 53–77
      • Full Text via CrossRef
      • [31]
      • T. Ujihara, R. Ohta, N. Hayashi, K. Kohata, J. Tanaka
      • Identification of Japanese and Chinese green tea cultivars by using simple sequence repeat markers to encourage proper labeling
      • Biosci. Biotechnol. Biochem., Volume 73, 2009, pp. 15–20
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (5)
      • [32]
      • L. Flores-Rentaria, A. Krohn
      • Scoring Microsatellite Loci
      • Microsatellites: Methods and Protocols, Series of Methods in Molecular Biology, S.K. Kantartzi, Volume vol. 1006, 2013, Humana Press, New York, pp. 319–336
      • [33]
      • A.C. Kelly, N.E. Mateus-Pinilla, M. Douglas, M. Douglas, P. Shelton, J. Novakofski
      • Microsatellites behaving badly: empirical evaluation of genotyping errors and subsequent impacts on population studies
      • Genet. Mol. Res., Volume 10, 2011, pp. 2534–2553
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (15)
      • [34]
      • A. Rafalski
      • Applications of single nucleotide polymorphisms in crop genetics
      • Curr. Opin. Plant Biol., Volume 5, 2002, pp. 94–100
      • Article
         | 
         PDF (97 K)
         | 
        View Record in Scopus
        Citing articles (503)
      • [35]
      • N.K. Korir, J. Han, L.F. Shangguan, C. Wang, E. Kayesh, Y.Y. Zhang, J.G. Fang
      • Plant variety and cultivar identification: advances and prospects
      • Crit. Rev. Biotechnol., Volume 33, 2013, pp. 111–125
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (10)
      • [36]
      • K. Weising, H. Nybom, M. Pfenninger, K. Wolff, G. Kahl
      • DNA Fingerprinting in Plants: Principals, Methods, and Applications
      • second ed., 2005, CRC Press, Boca Raton, Florida
      • [37]
      • C. Bazakos, A.O. Dulger, A.T. Uncu, S. Spaniolas, T. Spano, P. Kalaitzis
      • A SNP-based PCR–RFLP capillary electrophoresis analysis for the identification of the varietal origin of olive oils
      • Food Chem., Volume 134, 2012, pp. 2411–2418
      • Article
         | 
         PDF (919 K)
         | 
        View Record in Scopus
        Citing articles (12)
      • [38]
      • J.Q. Jin, L. Chen, M.Z. Yao, X.C. Wang, C.L. Ma
      • Simplification of EcoTILLING technique for tea plant
      • J. Tea Sci., Volume 30, 2010, pp. 19–26 (in Chinese with English abstract)
      • View Record in Scopus
        Citing articles (1)
      • [39]
      • J.B. Yang, S.X. Yang, H.T. Li, J. Yang, D.Z. Li
      • Comparative chloroplast genomes of Camellia species
      • PLoS One, Volume 8, 2013, e73053, doi:10.1371/journal.pone.0073053
      • Full Text via CrossRef
      • [40]
      • C.C. Zhang, L.Y. Wang, K. Wei, H. Cheng
      • Development and characterization of single nucleotide polymorphism markers in Camellia sinensis (Theaceae)
      • Genet. Mol. Res., Volume 13, 2014, pp. 5822–5831
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1)
      • [41]
      • W.P. Fang, L.W. Meinhardt, H.W. Tan, L. Zhou, S. Mischke, D. Zhang
      • Varietal identification of tea (Camellia sinensis) using nanofluidic array of single nucleotide polymorphism (SNP) markers
      • Hortic. Res., Volume 1, 2014, pp. 1–8
      • [42]
      • Fluidigm SNP Genotyping User Guide. Rev. H1, PN 68000098, South San Francisco, CA: Fluidigm Corporation. Rev., (http://www.mscience.com.au/upload/pages/fluidigmtech/fluidigm-snp-genotyping-user-guide-151112.pdf, 2015–2-10)
      • [43]
      • R. Peakall, P.E. Smouse
      • Genalex 6: genetic analysis in Excel. Population genetic software for teaching and research
      • Mol. Ecol. Notes, Volume 6, 2006, pp. 288–295
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (5784)
      • [44]
      • R. Peakall, P.E. Smouse
      • GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update
      • Bioinformatics, Volume 28, 2012, pp. 2537–2539
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1364)
      • [45]
      • L.P. Waits, G. Luikart, P. Taberlet
      • Estimating the probability of identity among genotypes in natural populations: cautions and guidelines
      • Mol. Ecol., Volume 10, 2001, pp. 249–256
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (603)
      • [46]
      • M. Nei, F. Tajima, Y. Tateno
      • Accuracy of estimated phylogenetic trees from molecular data
      • Anal. Chim. Acta, Volume 19, 1983, pp. 153–170
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1277)
      • [47]
      • D. Dieringer, C. Schlötterer
      • Microsatellite Analyser (MSA): a platform independent analysis tool for large microsatellite data sets
      • Mol. Ecol. Notes, Volume 3, 2003, pp. 167–169
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (966)
      • [48]
      • N. Saitou, M. Nei
      • The neighbor-joining method: a new method for reconstructing phylogenetic trees
      • Mol. Biol. Evol., Volume 4, 1987, pp. 406–425
      • View Record in Scopus
        Citing articles (34092)
      • [49]
      • Food and Agriculture Organization. Committee on Commodity Problems, Intergovernmental Group on Tea, 18th Session, Hangzhou, China. (ftp://ftp.fao.org/docrep/fao/Meeting/013/K2054e.pdf, 2015–2-12).
      • [50]
      • J. Wang, M. Lin, A. Crenshaw, A. Hutchinson, B. Hicks, M. Yeager, S. Berndt, W.Y. Huang, B. Hayes, S.J. Chanock, R.C. Jones, R. Ramakrishnan
      • High-throughput single nucleotide polymorphism genotyping using nanofluidic dynamic arrays
      • BMC Genomics, Volume 10, 2009, p. 561, doi:10.1186/1471-2164-10-561
      • Article
         | 
         PDF (932 K)
         | 
        View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (27)
      • [51]
      • W.P. Fang, L.W. Meinhardt, S. Mischke, C.M. Bellato, L. Motilal, D. Zhang
      • Accurate determination of genetic identity for a single cacao bean, using molecular markers with a nanofluidic system, ensures cocoa authentication
      • J. Agric. Food Chem., Volume 62, 2014, pp. 481–487
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (4)
      • [52]
      • L. Chen, Z. Apostolides, Z.M. Chen
      • Global Tea Breeding: Achievements, Challenges and Perspectives
      • 2012, Zhejiang University Press & Springer-Verlag, Zhejiang, China & Berlin, Germany
      • [53]
      • P. Bhardwaj, R.K. Sharma, R. Kumar, H. Sharma, P.S. Ahuja
      • SSR marker based DNA fingerprinting and diversity assessment in superior tea germplasm cultivated in Western Himalaya
      • Proc. Indian Natl. Sci. Acad., Volume 80, 2014, pp. 157–162
      • View Record in Scopus
         | 
        Full Text via CrossRef
      • [54]
      • M.Z. Yao, C.L. Ma, T.T. Qiao, J.Q. Jin, L. Chen
      • Diversity distribution and population structure of tea germplasms in China revealed by EST-SSR markers
      • Tree Genet. Genomes, Volume 8, 2012, pp. 205–220
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (17)
      • [55]
      • L. Chen, Z.X. Zhou, Y.J. Yang
      • Genetic improvement and breeding of tea plant (Camellia sinensis) in China: from individual selection to hybridization and molecular breeding
      • Euphytica, Volume 154, 2007, pp. 239–248
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (30)
      • [56]
      • T.L. Ming
      • Monograph of the Genus Camellia
      • 2000, Yunnan Science and Technology Press, Kunming, China
      • [57]
      • J.R. Sealy
      • A Revision of the Genus Camellia
      • 1958, Royal Horticultural Society, London
      • [58]
      • T.D. Vo
      • Assessing Genetic Diversity in Vietnam Tea [Camellia sinensis (L.) O. Kuntze] Using Morphology, Inter-Simple Sequence Repeat (lSSR) and Microsatellite (SSR) Markers
      • (Dissertation for the Doctoral Degree) 2006, Georg-August Göttingen University, Göttingen, Germany
      • [59]
      • F.N. Wachira, R. Waugh, W. Powell, C.A. Hackett
      • Detection of genetic diversity in tea (Camellia sinensis) using RAPD markers
      • Genome, Volume 38, 1995, pp. 201–210
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (138)
    • ⁎ 
      Corresponding author. Tel.: + 1 301 504 7477; fax: + 1 301 504 1998.

    For further details log on website :
    http://www.sciencedirect.com/science/article/pii/S2214514116300186
    at July 09, 2016
    Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest

    No comments:

    Post a Comment

    Newer Post Older Post Home
    Subscribe to: Post Comments (Atom)

    Advantages and Disadvantages of Fasting for Runners

    Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...

    • Pengalaman bekerja sebagai kerani kilang.
      Assalamualaikum dan salam sejahtera chu olls.     Alhamdulillah sudah seminggu saya melalui pengalaman bermakna ini. Sebagai seorang pel...
    • MIDA- INDUSTRI BERASASKAN KAYU
      Industri berasaskan kayu di Malaysia terdiri daripada  Kayu bergergaji; Venir dan produk panel yang termasuk papan lapis dan produk ...
    • Advantages and Disadvantages of Fasting for Runners
      Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...
    • UKIRAN KAYU DALAM MASYARAKAT MELAYU
      Seni ukiran kayu di kalangan masyarakat Melayu bukan sahaja terdapat pada rumah-rumah tetapi penjelmaan dan penerapannya terdapat pada is...
    • Laboratory Assessment of Forest Soil Respiration Affected by Wildfires under Various Environments of Russia
      International Journal of Ecology Volume 2017 (2017), Article ID 3985631, 10 pages https://doi.org/10.1155/2017/3985631 Author Evgeny  ...
    • Diploma Teknologi Berasaskan Kayu
      LATARBELAKANG POLITEKNIK KOTA KINABALU Politeknik Kota Kinabalu merupakan politeknik yang ketujuh ditubuhkan oleh Kementerian Pendidikan...
    • DIPLOMA REKA BENTUK PERABUT
      Sijil Teknologi Diploma Rekabentuk Perabot Kod Kursus :  K18 ...
    • Motif, Corak dan Ragi Tenun Melayu Riau
      Author MELAYU Riau kaya dengan khazanah budayanya. Antaranya yang amat menonjol adalah motif ornamen Melayunya, yang banyak dipakai untuk ...
    • RUBBER AND PVC FETISHISM
      Rubber fetishism , or  latex fetishism , is the fetishistic attraction to people wearing latex clothing or, in certain cases, to the garme...
    • 5 Jenama Foundation Terbaik, Beli Di Farmasi Je!
      Beberapa minggu sudah, penulis pernah mencadangkan beberapa jenama maskara terbaik yang mudah didapati pada harga berpatutan dari farmas...

    nuffnang ads

    Search This Blog

    Pages

    • Home

    About Me

    Unknown
    View my complete profile

    Blog Archive

    • ►  2018 (371)
      • ►  June (17)
        • ►  Jun 22 (8)
        • ►  Jun 12 (1)
        • ►  Jun 11 (2)
        • ►  Jun 05 (6)
      • ►  May (6)
        • ►  May 31 (6)
      • ►  April (75)
        • ►  Apr 30 (1)
        • ►  Apr 27 (1)
        • ►  Apr 26 (15)
        • ►  Apr 25 (10)
        • ►  Apr 24 (11)
        • ►  Apr 18 (2)
        • ►  Apr 12 (4)
        • ►  Apr 10 (5)
        • ►  Apr 09 (9)
        • ►  Apr 05 (17)
      • ►  March (65)
        • ►  Mar 27 (7)
        • ►  Mar 22 (2)
        • ►  Mar 20 (4)
        • ►  Mar 13 (14)
        • ►  Mar 12 (11)
        • ►  Mar 08 (7)
        • ►  Mar 06 (1)
        • ►  Mar 05 (1)
        • ►  Mar 01 (18)
      • ►  February (103)
        • ►  Feb 28 (25)
        • ►  Feb 27 (27)
        • ►  Feb 26 (10)
        • ►  Feb 20 (1)
        • ►  Feb 19 (9)
        • ►  Feb 09 (13)
        • ►  Feb 06 (6)
        • ►  Feb 05 (5)
        • ►  Feb 02 (7)
      • ►  January (105)
        • ►  Jan 25 (11)
        • ►  Jan 23 (5)
        • ►  Jan 16 (6)
        • ►  Jan 15 (9)
        • ►  Jan 14 (7)
        • ►  Jan 10 (1)
        • ►  Jan 09 (2)
        • ►  Jan 08 (4)
        • ►  Jan 04 (24)
        • ►  Jan 03 (2)
        • ►  Jan 02 (21)
        • ►  Jan 01 (13)
    • ►  2017 (6160)
      • ►  December (11)
        • ►  Dec 30 (11)
      • ►  November (31)
        • ►  Nov 26 (9)
        • ►  Nov 07 (8)
        • ►  Nov 06 (3)
        • ►  Nov 01 (11)
      • ►  October (345)
        • ►  Oct 31 (4)
        • ►  Oct 25 (42)
        • ►  Oct 24 (5)
        • ►  Oct 23 (15)
        • ►  Oct 22 (3)
        • ►  Oct 18 (7)
        • ►  Oct 17 (27)
        • ►  Oct 16 (14)
        • ►  Oct 15 (6)
        • ►  Oct 13 (18)
        • ►  Oct 12 (44)
        • ►  Oct 11 (57)
        • ►  Oct 09 (47)
        • ►  Oct 06 (14)
        • ►  Oct 05 (1)
        • ►  Oct 04 (13)
        • ►  Oct 03 (17)
        • ►  Oct 02 (11)
      • ►  September (186)
        • ►  Sept 29 (3)
        • ►  Sept 26 (7)
        • ►  Sept 25 (18)
        • ►  Sept 21 (29)
        • ►  Sept 20 (10)
        • ►  Sept 19 (11)
        • ►  Sept 18 (2)
        • ►  Sept 14 (19)
        • ►  Sept 13 (28)
        • ►  Sept 11 (3)
        • ►  Sept 10 (15)
        • ►  Sept 08 (5)
        • ►  Sept 06 (22)
        • ►  Sept 05 (14)
      • ►  August (158)
        • ►  Aug 29 (10)
        • ►  Aug 28 (73)
        • ►  Aug 27 (2)
        • ►  Aug 21 (4)
        • ►  Aug 18 (17)
        • ►  Aug 17 (4)
        • ►  Aug 14 (13)
        • ►  Aug 11 (5)
        • ►  Aug 10 (4)
        • ►  Aug 09 (7)
        • ►  Aug 08 (1)
        • ►  Aug 06 (3)
        • ►  Aug 04 (2)
        • ►  Aug 03 (13)
      • ►  July (290)
        • ►  Jul 26 (9)
        • ►  Jul 25 (7)
        • ►  Jul 24 (25)
        • ►  Jul 23 (5)
        • ►  Jul 21 (13)
        • ►  Jul 18 (19)
        • ►  Jul 17 (18)
        • ►  Jul 14 (17)
        • ►  Jul 13 (75)
        • ►  Jul 12 (10)
        • ►  Jul 11 (64)
        • ►  Jul 10 (26)
        • ►  Jul 09 (2)
      • ►  June (522)
        • ►  Jun 30 (1)
        • ►  Jun 27 (3)
        • ►  Jun 22 (13)
        • ►  Jun 21 (41)
        • ►  Jun 20 (3)
        • ►  Jun 19 (68)
        • ►  Jun 16 (33)
        • ►  Jun 15 (87)
        • ►  Jun 13 (25)
        • ►  Jun 12 (26)
        • ►  Jun 09 (20)
        • ►  Jun 08 (60)
        • ►  Jun 07 (54)
        • ►  Jun 06 (53)
        • ►  Jun 05 (35)
      • ►  May (684)
        • ►  May 31 (6)
        • ►  May 22 (3)
        • ►  May 21 (14)
        • ►  May 20 (12)
        • ►  May 19 (3)
        • ►  May 18 (26)
        • ►  May 17 (63)
        • ►  May 16 (27)
        • ►  May 15 (25)
        • ►  May 14 (16)
        • ►  May 07 (9)
        • ►  May 06 (26)
        • ►  May 05 (74)
        • ►  May 04 (126)
        • ►  May 03 (51)
        • ►  May 02 (153)
        • ►  May 01 (50)
      • ►  April (759)
        • ►  Apr 29 (56)
        • ►  Apr 28 (37)
        • ►  Apr 27 (67)
        • ►  Apr 26 (87)
        • ►  Apr 25 (6)
        • ►  Apr 10 (4)
        • ►  Apr 09 (5)
        • ►  Apr 08 (78)
        • ►  Apr 07 (57)
        • ►  Apr 06 (52)
        • ►  Apr 05 (53)
        • ►  Apr 04 (43)
        • ►  Apr 03 (94)
        • ►  Apr 02 (28)
        • ►  Apr 01 (92)
      • ►  March (1744)
        • ►  Mar 31 (90)
        • ►  Mar 30 (74)
        • ►  Mar 29 (58)
        • ►  Mar 28 (50)
        • ►  Mar 27 (95)
        • ►  Mar 26 (58)
        • ►  Mar 25 (98)
        • ►  Mar 24 (94)
        • ►  Mar 23 (77)
        • ►  Mar 22 (43)
        • ►  Mar 21 (54)
        • ►  Mar 20 (43)
        • ►  Mar 19 (88)
        • ►  Mar 18 (65)
        • ►  Mar 17 (63)
        • ►  Mar 16 (94)
        • ►  Mar 15 (79)
        • ►  Mar 14 (35)
        • ►  Mar 11 (10)
        • ►  Mar 10 (43)
        • ►  Mar 09 (40)
        • ►  Mar 08 (27)
        • ►  Mar 07 (40)
        • ►  Mar 06 (62)
        • ►  Mar 05 (48)
        • ►  Mar 04 (63)
        • ►  Mar 03 (54)
        • ►  Mar 02 (13)
        • ►  Mar 01 (86)
      • ►  February (715)
        • ►  Feb 28 (10)
        • ►  Feb 27 (61)
        • ►  Feb 26 (31)
        • ►  Feb 24 (22)
        • ►  Feb 23 (31)
        • ►  Feb 22 (42)
        • ►  Feb 21 (30)
        • ►  Feb 20 (42)
        • ►  Feb 19 (43)
        • ►  Feb 18 (46)
        • ►  Feb 17 (39)
        • ►  Feb 16 (39)
        • ►  Feb 15 (24)
        • ►  Feb 14 (54)
        • ►  Feb 13 (25)
        • ►  Feb 12 (78)
        • ►  Feb 10 (53)
        • ►  Feb 09 (22)
        • ►  Feb 01 (23)
      • ►  January (715)
        • ►  Jan 30 (25)
        • ►  Jan 28 (19)
        • ►  Jan 27 (36)
        • ►  Jan 26 (27)
        • ►  Jan 24 (27)
        • ►  Jan 22 (22)
        • ►  Jan 21 (58)
        • ►  Jan 20 (20)
        • ►  Jan 19 (30)
        • ►  Jan 18 (39)
        • ►  Jan 17 (26)
        • ►  Jan 16 (36)
        • ►  Jan 15 (62)
        • ►  Jan 14 (22)
        • ►  Jan 13 (20)
        • ►  Jan 12 (33)
        • ►  Jan 11 (32)
        • ►  Jan 10 (26)
        • ►  Jan 05 (11)
        • ►  Jan 04 (22)
        • ►  Jan 03 (35)
        • ►  Jan 02 (34)
        • ►  Jan 01 (53)
    • ▼  2016 (6885)
      • ►  December (986)
        • ►  Dec 31 (12)
        • ►  Dec 30 (23)
        • ►  Dec 29 (15)
        • ►  Dec 28 (29)
        • ►  Dec 27 (32)
        • ►  Dec 26 (29)
        • ►  Dec 25 (39)
        • ►  Dec 24 (43)
        • ►  Dec 23 (29)
        • ►  Dec 22 (28)
        • ►  Dec 21 (46)
        • ►  Dec 20 (28)
        • ►  Dec 19 (36)
        • ►  Dec 18 (14)
        • ►  Dec 17 (24)
        • ►  Dec 16 (10)
        • ►  Dec 15 (43)
        • ►  Dec 14 (55)
        • ►  Dec 13 (38)
        • ►  Dec 12 (45)
        • ►  Dec 11 (26)
        • ►  Dec 10 (48)
        • ►  Dec 09 (34)
        • ►  Dec 08 (22)
        • ►  Dec 07 (29)
        • ►  Dec 06 (15)
        • ►  Dec 05 (45)
        • ►  Dec 04 (38)
        • ►  Dec 03 (41)
        • ►  Dec 02 (41)
        • ►  Dec 01 (29)
      • ►  November (600)
        • ►  Nov 30 (38)
        • ►  Nov 29 (36)
        • ►  Nov 28 (43)
        • ►  Nov 27 (22)
        • ►  Nov 26 (27)
        • ►  Nov 25 (39)
        • ►  Nov 24 (27)
        • ►  Nov 23 (37)
        • ►  Nov 22 (21)
        • ►  Nov 21 (32)
        • ►  Nov 20 (20)
        • ►  Nov 19 (31)
        • ►  Nov 18 (34)
        • ►  Nov 17 (29)
        • ►  Nov 16 (21)
        • ►  Nov 15 (33)
        • ►  Nov 14 (16)
        • ►  Nov 13 (3)
        • ►  Nov 12 (3)
        • ►  Nov 11 (1)
        • ►  Nov 09 (2)
        • ►  Nov 07 (14)
        • ►  Nov 04 (16)
        • ►  Nov 03 (17)
        • ►  Nov 02 (23)
        • ►  Nov 01 (15)
      • ►  October (374)
        • ►  Oct 31 (15)
        • ►  Oct 30 (2)
        • ►  Oct 29 (4)
        • ►  Oct 28 (25)
        • ►  Oct 27 (19)
        • ►  Oct 26 (16)
        • ►  Oct 25 (11)
        • ►  Oct 24 (14)
        • ►  Oct 23 (12)
        • ►  Oct 21 (14)
        • ►  Oct 20 (19)
        • ►  Oct 19 (21)
        • ►  Oct 18 (17)
        • ►  Oct 17 (15)
        • ►  Oct 16 (20)
        • ►  Oct 15 (12)
        • ►  Oct 14 (11)
        • ►  Oct 13 (21)
        • ►  Oct 12 (13)
        • ►  Oct 11 (6)
        • ►  Oct 10 (12)
        • ►  Oct 09 (17)
        • ►  Oct 08 (10)
        • ►  Oct 07 (11)
        • ►  Oct 06 (19)
        • ►  Oct 05 (13)
        • ►  Oct 03 (5)
      • ►  September (406)
        • ►  Sept 29 (6)
        • ►  Sept 28 (2)
        • ►  Sept 27 (12)
        • ►  Sept 16 (20)
        • ►  Sept 15 (34)
        • ►  Sept 14 (39)
        • ►  Sept 13 (32)
        • ►  Sept 12 (36)
        • ►  Sept 11 (18)
        • ►  Sept 10 (16)
        • ►  Sept 07 (6)
        • ►  Sept 06 (26)
        • ►  Sept 05 (14)
        • ►  Sept 04 (44)
        • ►  Sept 03 (17)
        • ►  Sept 02 (38)
        • ►  Sept 01 (46)
      • ►  August (777)
        • ►  Aug 31 (13)
        • ►  Aug 29 (22)
        • ►  Aug 28 (13)
        • ►  Aug 27 (26)
        • ►  Aug 26 (18)
        • ►  Aug 25 (14)
        • ►  Aug 24 (13)
        • ►  Aug 23 (22)
        • ►  Aug 22 (23)
        • ►  Aug 21 (20)
        • ►  Aug 20 (23)
        • ►  Aug 19 (13)
        • ►  Aug 18 (31)
        • ►  Aug 17 (36)
        • ►  Aug 16 (17)
        • ►  Aug 15 (33)
        • ►  Aug 14 (24)
        • ►  Aug 13 (28)
        • ►  Aug 12 (28)
        • ►  Aug 11 (28)
        • ►  Aug 10 (59)
        • ►  Aug 09 (33)
        • ►  Aug 08 (39)
        • ►  Aug 07 (23)
        • ►  Aug 06 (36)
        • ►  Aug 05 (23)
        • ►  Aug 04 (25)
        • ►  Aug 03 (17)
        • ►  Aug 02 (26)
        • ►  Aug 01 (51)
      • ▼  July (890)
        • ►  Jul 31 (27)
        • ►  Jul 30 (31)
        • ►  Jul 29 (29)
        • ►  Jul 28 (40)
        • ►  Jul 27 (32)
        • ►  Jul 26 (16)
        • ►  Jul 25 (5)
        • ►  Jul 24 (45)
        • ►  Jul 23 (16)
        • ►  Jul 22 (42)
        • ►  Jul 21 (11)
        • ►  Jul 20 (41)
        • ►  Jul 19 (31)
        • ►  Jul 18 (35)
        • ►  Jul 17 (41)
        • ►  Jul 16 (21)
        • ►  Jul 15 (23)
        • ►  Jul 14 (38)
        • ►  Jul 13 (49)
        • ►  Jul 12 (42)
        • ►  Jul 11 (25)
        • ►  Jul 10 (48)
        • ▼  Jul 09 (33)
          • Can You Wash Your Hair After Two Days of Getting a...
          • Types of Keratin Treatments
          • Home Protein Treatment for Hair
          • Homemade Egg Protein Treatment for Hair
          • How to Use Egg for Hair Growth
          • The Risks & Benefits of Taking Turmeric
          • What Does the Herb Turmeric Do?
          • The Benefits of Curcuma
          • Does Water Aerobics Offer the Same Benefits as Reg...
          • How Many Calories Can You Burn by Running in Water?
          • How Many Calories Does Jogging in Place Burn?
          • Can Poor Nutrition Stunt a Teenager's Growth?
          • Goal Setting in Relationships
          • Difference Between Human Growth & Development
          • Growth Stages for a Human
          • Identification of the varietal origin of processed...
          • Oil and fatty acid accumulation during coriander (...
          • Isolation and characterization of a novel Rhabdovi...
          • Fabrication and characterization of mesoporous sil...
          • Utilization of sorghum, rice, corn flours with pot...
          • A Robust CRISPR/Cas9 System for Convenient, High-E...
          • RNA-Seq analysis of the wild barley (H. spontaneum...
          • Transcriptional profiling by DDRT-PCR analysis rev...
          • A review on plants extract mediated synthesis of s...
          • An A20/AN1-zinc-finger domain containing protein g...
          • Stages of Baby Development From Conception to Birth
          • How to Get Fit at 50 for Men
          • Physical Development Between Ages 4 and 9
          • Physical Development in the Elderly
          • How to Care for the Emotional Needs of the Elderly
          • Activities That Stimulate Cognition in the Elderly
          • Tips on Effective Communication With the Elderly
          • Physical Effects of Elder Abuse
        • ►  Jul 08 (38)
        • ►  Jul 07 (19)
        • ►  Jul 06 (10)
        • ►  Jul 05 (14)
        • ►  Jul 04 (13)
        • ►  Jul 03 (20)
        • ►  Jul 02 (26)
        • ►  Jul 01 (29)
      • ►  June (1003)
        • ►  Jun 30 (29)
        • ►  Jun 29 (43)
        • ►  Jun 28 (27)
        • ►  Jun 27 (33)
        • ►  Jun 26 (49)
        • ►  Jun 25 (30)
        • ►  Jun 24 (32)
        • ►  Jun 23 (42)
        • ►  Jun 22 (38)
        • ►  Jun 21 (20)
        • ►  Jun 20 (30)
        • ►  Jun 19 (37)
        • ►  Jun 18 (15)
        • ►  Jun 17 (12)
        • ►  Jun 16 (52)
        • ►  Jun 15 (59)
        • ►  Jun 14 (49)
        • ►  Jun 13 (38)
        • ►  Jun 12 (39)
        • ►  Jun 11 (44)
        • ►  Jun 10 (22)
        • ►  Jun 09 (34)
        • ►  Jun 08 (39)
        • ►  Jun 07 (28)
        • ►  Jun 06 (38)
        • ►  Jun 05 (19)
        • ►  Jun 04 (20)
        • ►  Jun 03 (27)
        • ►  Jun 02 (27)
        • ►  Jun 01 (31)
      • ►  May (648)
        • ►  May 31 (32)
        • ►  May 30 (48)
        • ►  May 29 (46)
        • ►  May 28 (43)
        • ►  May 27 (19)
        • ►  May 26 (37)
        • ►  May 25 (29)
        • ►  May 24 (22)
        • ►  May 23 (23)
        • ►  May 22 (18)
        • ►  May 21 (18)
        • ►  May 20 (22)
        • ►  May 19 (28)
        • ►  May 18 (12)
        • ►  May 17 (24)
        • ►  May 16 (9)
        • ►  May 15 (18)
        • ►  May 14 (13)
        • ►  May 13 (16)
        • ►  May 12 (6)
        • ►  May 11 (15)
        • ►  May 10 (15)
        • ►  May 09 (25)
        • ►  May 08 (14)
        • ►  May 07 (15)
        • ►  May 06 (10)
        • ►  May 04 (21)
        • ►  May 03 (22)
        • ►  May 02 (9)
        • ►  May 01 (19)
      • ►  April (490)
        • ►  Apr 30 (7)
        • ►  Apr 29 (21)
        • ►  Apr 28 (19)
        • ►  Apr 27 (15)
        • ►  Apr 26 (12)
        • ►  Apr 25 (19)
        • ►  Apr 24 (13)
        • ►  Apr 23 (24)
        • ►  Apr 22 (24)
        • ►  Apr 21 (22)
        • ►  Apr 20 (19)
        • ►  Apr 19 (46)
        • ►  Apr 18 (24)
        • ►  Apr 17 (15)
        • ►  Apr 16 (19)
        • ►  Apr 15 (8)
        • ►  Apr 14 (19)
        • ►  Apr 13 (22)
        • ►  Apr 12 (18)
        • ►  Apr 11 (11)
        • ►  Apr 10 (13)
        • ►  Apr 09 (12)
        • ►  Apr 08 (12)
        • ►  Apr 07 (15)
        • ►  Apr 06 (16)
        • ►  Apr 05 (10)
        • ►  Apr 04 (8)
        • ►  Apr 03 (15)
        • ►  Apr 01 (12)
      • ►  March (445)
        • ►  Mar 31 (7)
        • ►  Mar 30 (10)
        • ►  Mar 29 (17)
        • ►  Mar 28 (15)
        • ►  Mar 27 (8)
        • ►  Mar 26 (11)
        • ►  Mar 25 (10)
        • ►  Mar 24 (9)
        • ►  Mar 23 (13)
        • ►  Mar 22 (9)
        • ►  Mar 21 (13)
        • ►  Mar 20 (9)
        • ►  Mar 19 (15)
        • ►  Mar 18 (14)
        • ►  Mar 17 (11)
        • ►  Mar 16 (15)
        • ►  Mar 15 (23)
        • ►  Mar 14 (26)
        • ►  Mar 13 (20)
        • ►  Mar 12 (14)
        • ►  Mar 11 (18)
        • ►  Mar 10 (27)
        • ►  Mar 09 (18)
        • ►  Mar 08 (25)
        • ►  Mar 07 (11)
        • ►  Mar 06 (15)
        • ►  Mar 05 (18)
        • ►  Mar 04 (9)
        • ►  Mar 03 (14)
        • ►  Mar 02 (7)
        • ►  Mar 01 (14)
      • ►  February (258)
        • ►  Feb 29 (22)
        • ►  Feb 28 (14)
        • ►  Feb 27 (12)
        • ►  Feb 26 (4)
        • ►  Feb 25 (17)
        • ►  Feb 24 (16)
        • ►  Feb 23 (16)
        • ►  Feb 22 (8)
        • ►  Feb 21 (23)
        • ►  Feb 20 (6)
        • ►  Feb 19 (5)
        • ►  Feb 18 (3)
        • ►  Feb 17 (9)
        • ►  Feb 16 (17)
        • ►  Feb 15 (20)
        • ►  Feb 14 (10)
        • ►  Feb 13 (17)
        • ►  Feb 11 (3)
        • ►  Feb 10 (1)
        • ►  Feb 08 (2)
        • ►  Feb 07 (5)
        • ►  Feb 05 (2)
        • ►  Feb 04 (10)
        • ►  Feb 03 (7)
        • ►  Feb 02 (1)
        • ►  Feb 01 (8)
      • ►  January (8)
        • ►  Jan 30 (4)
        • ►  Jan 10 (4)
    • ►  2013 (23)
      • ►  February (18)
        • ►  Feb 07 (1)
        • ►  Feb 06 (2)
        • ►  Feb 05 (8)
        • ►  Feb 04 (5)
        • ►  Feb 02 (1)
        • ►  Feb 01 (1)
      • ►  January (5)
        • ►  Jan 31 (4)
        • ►  Jan 30 (1)

    Report Abuse

    Follower

    Translate

    Total Pageviews

    nuffnang ads

    Nuffnang Ads

    nuffnang ads

    Nuffnang Ads

    Picture Window theme. Theme images by sndrk. Powered by Blogger.