Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.
Blog List
Wednesday, 29 June 2016
Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.)
Published Date
June 2016, Vol.4(3):188–198, doi:10.1016/j.cj.2016.03.002
Open Access, Creative Commons license, Funding information
Title
Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.)
Author
Xinguo Wang
Yanli Wang
Ruixia Xiao
Xin Chen
Jiangping Ren,
National Wheat Engineering Research Center, Agricultural University of Henan, Zhengzhou 450002, China
Received 27 November 2015. Revised 3 March 2016. Accepted 15 March 2016. Available online 30 March 2016. Abstract The purpose of this study was to characterizeTa14Shomoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of threeTa14Shomoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated asTa14S-2A,Ta14S-2BandTa14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the threeTa14Sgenes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the threeTa14Sgenes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription ofTa14S-2Bwas clearly higher during seed germination, whereas expressions ofTa14S-2AandTa14S-2Dwere up-regulated at the beginning of seed imbibition (0–12 h), but declined thereafter. The results suggested that the threeTa14Shomoeologous genes have regulatory roles in seed development and germination. Keywords
Common wheat
Gene expression
Homoeologous genes
Developmental regulation
1 Introduction
The 14-3-3 proteins are a family of highly conserved regulatory proteins found in virtually all eukaryotes. The N- and C-ends of these proteins are highly variable whereas the core structures are highly conserved [1]. These molecules are small acidic soluble proteins with a molecular mass of approximately 30 kDa. They usually form homo- and hetero-dimers to interact with diverse target proteins by specific phosphoserine/phosphothreonine-binding activity [2] and [3]. To date, there are over three hundred proteins identified as their interacting proteins [4] and [5], and the outcomes of binding are diverse, including alteration in conformation, subcellular localization and stabilization of the interacting proteins. They also mediate formation of protein complexes [6], [7], [8] and [9]. The physiological function of these proteins in plants has been the focus of considerable research. Various 14-3-3 isoforms have been isolated from diverse species including fifteen known protein isoforms in Arabidopsis[10], eight in rice [11], five in barley [12] and 7 potential isoforms in wheat [13], [14], [15], [16] and [17]. Plant 14-3-3 proteins can be divided into two classes, the epsilon and the non-epsilon groups, based on sequence similarity and phylogenetic analyses of sequences obtained from Arabidopsis[3]. Functional analysis revealed that increased or decreased expression of 14-3-3 protein genes caused a number of phenotypic, developmental and stress tolerance changes. For example, in rice plants transformed with an over-expression construct of the maize 14-3-3 protein gene, GF14–6, tolerance to drought stress and response to pathogen infection were changed [18]. When overexpressed in Arabidopsis plants wheat 14-3-3 protein caused shorter primary roots, delayed flowering and retarded growth rates [16]. The overexpression of cotton 14-3-3 protein Gh14-3-3 L promoted fiber elongation, leading to an increase in mature fiber length. By contrast, the suppression of the expression of Gh14-3-3 L, Gh14-3-3 e and Gh14-3-3 h in cotton slowed down fiber initiation and elongation [19]. These results indicated that some 14-3-3 protein-coding genes have roles in plant development and stress response.
Wheat is a globally important crop, accounting for 20% of the calories consumed by humans [20]. Research that focuses on mechanisms of developmental regulation at the molecular level has potential to accelerate progress of wheat improvement. Although 14-3-3 proteins are increasingly implicated as key factors in developmental regulation [21], [22], [23] and [24], little is known about such genes in wheat seed development. Because hexaploid wheat contains three sets of chromosomes, Ta14-3-3 genes are likely to occur as homoeologous triplicates. Previously, we isolated a wheat cDNA designated as Ta14S with an open reading frame encoding a putative 14-3-3 protein [15]. To further clarify a regulatory function in wheat seed development, we isolated the genomic and cDNA sequences of Ta14S homoeologs in hexaploid wheat and located the genes to chromosomes using Chinese Spring nullisomic–tetrasomic lines. In addition, we analyzed their expression patterns in different tissues and at different seed developmental and germination stages.
2 Materials and methods
2.1 Plant sample preparation
Common wheat (Triticum aestivum L.) cultivar (cv.) Luohan 2 was used for gene cloning and expression analysis. After being sterilized, seeds were germinated on moist filter paper in growth chambers at 25 °C under 12-h light/12-h dark conditions and transplanted into pots in a naturally lit glasshouse with normal irrigation and fertilization until mature. Dry seed embryos, primary roots and shoots at 1 day post-germination, roots and fully expanded leaves at 10 days post-germination, leaves at the tillering stage, stems at jointing, flag leaves, young panicles at heading, and developing seeds at 5, 10, 15, 20, 25, 30 and 35 DAP (days after pollination) were sampled. For germination treatment, mature seeds were surface-sterilized and then imbibed water from moist filter paper in Petri dishes in a temperature-controlled cultivation chamber (16 h photoperiod at 25 °C). Seeds were collected at 0, 6, 12, 24, 36 and 48 h after initiation of imbibition.
All collected plant materials were frozen in liquid nitrogen immediately after collection and stored at − 80 °C until used. Three biologically independent replicates were assayed to ascertain reproducibility. A set of Chinese Spring (CS) nullisomic–tetrasomic lines, kindly provided by Dr. Xianchun Xia, Chinese Academy of Agricultural Sciences, was used to determine the chromosomal locations of Ta14S.
2.2 DNA extraction, primer design, PCR and sequencing
Genomic DNA was isolated from wheat seeds using a CTAB method [25]. Gene-specific primers were designed based on the sequence of Ta14S using Primer Premier 5.0 software (http://www.premierbiosoft.com/) and synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. (http://www.bgitechsolutions.cn/). PCR were performed in a Biametra-T3000 thermal cycler in total volumes of 20 μL, including 2 μL 10 × PCR buffer, 100 mmol L− 1 of each of dNTP, 5 pmol of each primer, 1 unit of Taq DNA polymerase (TIANGEN Biotech Co., Ltd., Beijing, http://www.tiangen.com/) and 100 ng of template DNA. Reaction conditions were 95 °C for 3 min followed by 35 cycles of 94 °C for 30 s, annealing at 55 °C for 1 min and 72 °C for 1–2 min, with a final extension at 72 °C for 10 min. PCR products were separated by electrophoresis in 1.0% agarose gels. Targeted fragments of expected size were recovered and cloned into the pMD18-T vector and sequenced by Beijing Liuhe Huada Gene Technology Co., Ltd. (http://www.bgitechsolutions.cn/). To ensure sequencing accuracy PCR and DNA sequencing were repeated at least three times.
2.3 RNA extraction and first-strand cDNA synthesis
Total RNA extractions from embryos and seeds were carried out using a hot-phenol method [26] and from leaves and roots using TRIzol Reagent (Invitrogen, Shanghai) according to the manufacturer's instructions. Quality and concentrations of total RNA were measured by spectrophotometer (NanoDrop ND-1000, Wilmington, USA) and agarose gel electrophoresis. Equal amounts (2 μg) of total RNA were transcribed into cDNA in a 20 μL reaction system containing 50 mmol L− 1 Tris–HCl (pH 8.3), 75 mmol L− 1 MgCl2, 10 mmol L− 1 DTT, 50 mmol L− 1 dNTPs, 200 U M-MLV reverse transcriptase (Promega, Madison, WI) and 50 pmol Oligo-dT15 anchor primer. Reverse transcription was performed for 60 min at 42 °C with a final denaturation step at 95 °C for 5 min.
2.4 Rapid amplification of cDNA ends (RACE)
mRNA was purified through oligotex chromatography (Clontech, Beijing) from total RNA and 3′-RACE and 5′-RACE were performed using a SMART-RACE cDNA amplification kit (Clontech, Beijing) according to the manufacturer's protocol. Gene-specific primers used for PCR were 3′-GSP (3′-RACE) and 5′-GSP (5′-RACE), respectively (Table 1). PCR was performed according to the manufacturer's protocol (Clontech). PCR conditions were 94 °C for 4 min, followed by 6 cycles of 94 °C for 30 s, 60 °C/58 °C for 30 s and 72 °C for 3 min, followed by 20 cycles of 94 °C for 30 s, 56 °C for 30 s, 72 °C for 3 min and finally 72 °C for 10 min. PCR products were separated by 1% agarose gel electrophoresis, and subcloned into the pMD18-T vector (TaKaRa, Dalian) and sequenced.
Table 1. Primer sequences for gene cloning, RACE, chromosome location and real-time PCR.
Name
Primer sequence (5′–3′)
Notes
Ta14S-F
GAACTGTGAAGATGACGGCA
For amplifying gDNA and cDNA
Ta14S-R
AGCAGAACGAAAATACGAAC
3′-GSP
CGTGATAACTTGACCCTCTGGACTTC
3′-RACE
5′-GSP
GGAAGACGGGACAAGGTGGGTTT
5′-RACE
Ta14S-F1
ACGACTCAAGCGAGGGGCA
For 2D chromosome location and real time RT-PCR
Ta14S-R1
CGCCTGCTACGCTACAAGGAC
Ta14S-F2
GTCAATGACCGTTGCAATGTG
For 2B chromosome location and real time RT-PCR
Ta14S-R2
GCCACCACCACCACTGTATG
Ta14S-F3
GGAGGAGGAGATCAGGGAGGCT
For 2A chromosome location and real time RT-PCR
Ta14S-R3
TGCGACAACAACCATAACAGGG
β-actin-F
TTTGAAGAGTCGGTGAAGGG
Real time RT-PCR
β-actin-R
TTTCATACAGCAGGCAAGCA
2.5 Real-time quantitative RT-PCR
Aliquots of 1 μg of total RNA were used for first-strand cDNA synthesis using a Primecript Reagent Kit with gDNA Eraser (Perfect real-time) according to the manufacturer's instructions (TaKaRa). Real-time quantitative RT-PCR was performed using an Eppendorf Realplex4 Mastercycler EP Gradient S machine (Eppendorf, Hamburg, Germany). Homoeologous Ta14S gene-specific primers were used for real-time quantitative PCR analysis. For normalization, the wheat β-actin gene (GenBank accession number: AB181991) was amplified as an endogenous control (Table 1).
PCR was performed with the SYBR Green quantitative RT-PCR kit (TaKaRa) following the manufacturer's instructions. PCR cycling conditions comprised an initial cycle at 95 °C for 30 s, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 35 s and a final extension of 7 min at 72 °C. No-template negative controls (H2O control) were set up using gene-specific primer pairs, and no-RT-PCR controls were set up in duplicate using actin gene primers. Reactions were conducted in triplicate to ensure reproducibility of results.
The cycle threshold (Ct), defined as the PCR cycle at which a statistically significant increase in reporter fluorescence is first detected, was used as a measure of the starting copy number of the target gene. Relative quantities of target gene expression levels were determined using the comparative Ct method. Relative quantification for each target gene was calculated by the 2− ΔΔCt method using β-actin as an internal reference gene for comparing data from different PCR runs or cDNA samples [27].
3 Results
3.1 Isolation of cDNA sequences of wheat Ta14S homoeologs
To isolate the full-length cDNA sequence of the three wheat Ta14S homoeologs, the gene-specific primer pair Ta14S-F and Ta14S-R (Table 1) was designed according to the previously reported cDNA sequence of Ta14S (GB: JN650603) [15] in order to amplify the complete open reading frames (ORF) and cDNA from an immature seed mixture used as template. An approximate 1100 bp band was obtained; sequence alignment indicated that three different cDNA sequences were different, with lengths of 1052, 1056 and 1058 bp, and we temporarily named them as Ta14S-1, Ta14S-2and Ta14S-3, respectively. RACE was then performed to isolate the 5′ and 3′-end fragments with specific primers (Table 1). Agarose gel analysis showed three 5′-end fragments of about 598, 562, 484 bp and three 3′-end of fragments of about 387, 392 and 389 bp. According to the overlaps between the 5′- and 3′-end fragments and ORF sequences, three full-length cDNAs were obtained. As shown in Fig. 1, the full-length cDNAs of Ta14S-1, Ta14S-2 and Ta14S-3 were 1269, 1238 and 1156 bp, including the 189, 153 and 75 bp of 5′ UTR, 287, 292 and 289 bp of 3′ UTR, respectively. The ORF of the three homoeologous genes were 792 bp. The sequence identity of Ta14S-1, Ta14S-2 and Ta14S-3 was 91%. Compared with Ta14S-1, Ta14S-2has a 45 bp deletion and a 9 bp insertion in the 5′ UTR, and Ta14S-3 has a 23 bp and 101 bp deletion in the 5′ UTR. Ta14S-1, Ta14S-2 and Ta14S-3 have 3, 4 and 5 TGG repeats, respectively (Fig. 1). Although there were 22 single-base differences in the coding regions, amino acid sequences of the three genes were almost completely conserved except for residues Asp and Asn being changed to Gly and His at position 241 and 257, respectively (Fig. 2).
Fig. 1. Nucleotide sequence alignments of the Ta14S genes (Ta14S-1, Ta14S-2 and Ta14S-3) amplified from genomic DNA and cDNA from wheat cv. Luohan No. 2. Exons and introns are shown in black and gray texts, respectively. Sequence identities and differences are shown in black and green shading, respectively. The positions of 5′ and 3′-UTR primers used for gene cloning and RACE are indicated by arrows. Different colored boxes indicate the positions of primers used for chromosome mapping. The red rectangular frames show the locations of the start (ATG) and stop (TAA) codons, respectively.
Fig. 2. Alignment of amino acid sequences of the three Ta14S homoeologous genes. Sequence similarities and differences are shown in black and green texts, respectively.
3.2 Gene structure and chromosomal locations of the wheat Ta14S homoeologs
In order to better understand the genesis of the three Ta14S homoeologs, their genomic sequences were isolated with the specific primer pair Ta14S-F/Ta14S-R (Table 1). To correctly identify exon and intron segments of the three genes, we compared the genomic and corresponding cDNA sequences using DNAMAN software. As shown in Fig. 1, the three Ta14S homoeologous genes were composed of five exons and four introns. All exons and the first, second and fourth intron sequences of the three genes were relatively conserved, whereas the third introns had more frequent base substitutions and insertions/deletions. Compared with Ta14S-2 and Ta14S-3, Ta14S-1 had 9, 207 and 3 bp deletions in the third intron, respectively.
To determine the chromosome locations of the Ta14S homoeologs in the wheat genome, specific primer pairs Ta14S-F1/R1, Ta14S-F2/R2 and Ta14S-F3/R3 (Table 1) were designed according to their 3′-end genomic sequences and tested on nulli-tetrasomic lines of Chinese Spring as template to amplify the corresponding genes in the A, B and D genomes. Homoeologous Ta14S genes Ta14S-1, Ta14S-2 and Ta14S-3were amplified in all nulli-tetrasomic lines except N2D-T2A, N2B-T2A and N2A-T2B (Fig. 3); Ta14S-1 amplified by primer pair Ta14S-F1/R1 was located on wheat chromosome 2D (Fig. 3a). Similarly, Ta14S-2 and Ta14S-3 amplified by primer pairs Ta14S-F2/R2 and Ta14S-F3/R3, respectively, were located on chromosomes 2B and 2A (Fig. 3b and c). Accordingly, Ta14S-1, Ta14S-2 and Ta14S-3 were renamed as Ta14S-2D, Ta14S-2B and Ta14S-2A, respectively.
Fig. 3. Three homoeologous Ta14S genes were located using Chinese Spring (C.S.) and its nulli-tetrasomics lines. M: DNA ladder; a, b and c indicate that PCR products were specifically amplified with primer pairs Ta14S-F1/Ta14S-R1, Ta14S-F2/Ta14S-R2 and Ta14S-F3/Ta14S-R3.
3.3 Phylogenetic analyses of the Ta14S homoeologs
To determine the evolutionary relationship among the wheat 14-3-3 proteins and other plant species, 32 amino acid sequences from wheat, rice, barley and Arabidopsiswere aligned using Mega 6.0. An unrooted tree was constructed based on the alignment using the Neighbor-Joining method. As shown in Fig. 4, the tree was clearly divided into two distinct branches, non-epsilon (I) and epsilon (II). The non-epsilon group contained most of the proteins, whereas the epsilon group comprised only four proteins. The non-epsilon group can be further divided into two subgroups, each including both monocotyledonous and dicotyledonous species. Ta14S-2A, Ta14S-2B and Ta14S-2D appear to belong to the non-epsilon group and all closely resemble Hv14A. In addition, four other 14-3-3 proteins of barley (Hv14B, Hv14C, Hv14D and Hv14E) cluster in small sub-groups with five reported 14-3-3 proteins of wheat (Ta14A, Ta14R1, Ta14R2, Ta14Win2 and Ta14Win1), indicating that wheat and barley have a close phylogenetic relationship.
Fig. 4. Phylogenetic analysis of Arabidopsis, rice, barley and wheat 14-3-3 proteins using the MEGA Neighbor-Joining program. GF14Chi, GF14Omega, GF14Psi, GF14Phi, GF14Upsilon, GF14Lambda, GF14Nu, GF14Kappa, GF14Mu, GF14Epsilon, GF14Omicron and GF14Iota are from Arabidopsis; Ta14A, Ta14B, TaR1, TaR2, TaWIN1, TaWIN2, Ta14S-2A, Ta14S-2B and Ta14S-2D are from wheat; Hv14A-E is from barley; and OsGF14A-F is from rice.
3.4 Transcription profiling of the Ta14S homoeologs in different wheat tissues
To define possible functions of the Ta14S homoeologs, we performed tissue-specific expression analyses of the three homoeologous Ta14S genes at different growth and developmental stages, including dry seed embryos, primary roots and shoots at 1 day post-germination, roots and fully expanded leaves at 10 days poat-germination, leaves at tillering, stems at jointing, flag leaves, young panicles at heading and immature seeds (Fig. 5a). The expression of all three Ta14S homoeologs was detected in all tissues examined, and all shared high expression levels in 1-day-old primary roots after germination. Moreover, the expressions of the three homoeologs changed with growth and developmental stages. They all showed high expression levels in early vegetative growth and decreased with seed maturity. Expression differences between the three homoeologs were also detected. For example, Ta14S-2B had relatively higher expression in 1-day-old roots and shoots, 10-day-old roots, leaves at tillering, and stems at jointing, whereas Ta14S-2D was highly expressed in 10-day-old fully expanded leaves.
Fig. 5. Expression patterns of the three Ta14S homoeologous genes in wheat. (a) In different tissues. 1, dry seed embryos; 2, roots at 1 day post-germination; 3, shoots 1 day after germination; 4, roots at 10 days post-germination; 5, fully expanded leaves at 10 days post-germination; 6, leaves at tillering; 7, stems at jointing; 8, flag leaves at heading; 9, immature ears at heading; 10, seeds at 10 DAP; 11, seeds at 25 DAP. (b) During seed development stages. (c) During seed germination.
3.5 Transcription profiling of the Ta14S homoeologs during seed development and seed germination
Total RNA was extracted from immature and mature seeds, and qRT-PCR was performed to define the expression profiles of the three Ta14S homoeologs. The expression of the three Ta14S homoeologs during seed development showed fluctuating trends (Fig. 5b). All three shared highest expression levels at early stages of development (5 DAP), followed by decreased levels in the middle stages (10–15 DAP). Increases in transcription levels of all three genes were detected at 20 DAP, followed by decreases to minimum levels at 25 DAP. However, the three homoeologs showed different transcript abundances during seed development. For instance, Ta14S-2A was more highly expressed than Ta14S-2B and Ta14S-2D at 15, 20 and 35 DAP, but the expression levels of Ta14S-2A and Ta14S-2D at 30 DAP were lower than that of Ta14S-2B.
The expression of the three Ta14S homoeologous genes during seed germination showed a gradually up-regulated trend at the beginning of seed imbibition (0–12 h) (Fig. 5c). Afterwards, significant differences in transcript were observed among the genes. The transcript levels of Ta14S-2A and Ta14S-2D showed a gradual downward trend at 24 and 36 h, and then increased at 48 h (Fig. 5c). By contrast, the transcription of Ta14S-2B was elevated in a time-dependent manner, and its transcript level was consistently higher than that of Ta14S-2A and Ta14S-2D during the entire seed germination process (Fig. 5c). These results indicate that all three homoeologs have a role in the seed germination process in wheat.
4 Discussion
The 14-3-3 proteins are phosphoserine-binding proteins that have vital roles in regulating a wide range of target proteins participating in diverse signal transduction and gene regulation, such as primary metabolism, plant development, protein trafficking, signal transduction and biotic/abiotic stress response [18], [19], [28] and [29]. Therefore, isolation and functional analysis of 14-3-3 genes are critical steps in understanding their regulatory roles. In order to study the functions of 14S orthologs encoding 14-3-3 proteins in wheat seed development, genomic DNA and cDNA sequences of one set of Ta14S homoeologs from hexaploid wheat were isolated and characterized. Sequence analysis revealed that the gene structures and numbers of amino acids were similar, but the three genes were distinguished by their 5′- and 3′-UTR. The three genes were located on group 2 chromosomes and named as a homoeologous set (Ta14S-2A, Ta14S-2B and Ta14S-2D). Phylogenetic analysis revealed that they are members of the non-epsilon group (I) of 14-3-3 proteins, sharing 50% to 100% identity with amino acid sequences in this group, which comprises more than 85% of plant 14-3-3 proteins. These results are in agreement with previous research [30].
qRT-PCR assays demonstrated that all three Ta14S homoeologs were constitutively transcribed in various wheat organs at different developmental stages, including dry seed embryos, primary roots and shoots 1 day after germination, roots and fully expanded leaves 10 days after germination, leaves at tillering, stems at jointing, flag leaves and immature ears at heading, seeds at 10 and 25 days post-pollination. Moreover, mRNA abundances of the three genes also varied between tissues, and developmental stages. Interestingly, the three Ta14S homoeologous genes appeared to be highly expressed in primary roots 1 day post-germination, compared to other plant organs. It was reported that a wheat Ta14-3-3 gene in transgenic Arabidopsisplayed an important role during root development [16]. Collectively, it can be concluded that the high expression of all three Ta14S homoeologs in young roots may regulate initial elongation of the radical and affect root development.
Earlier studies showed that 14-3-3 proteins are involved in signal transduction pathways with roles in late embryo development in seeds and germination. It was reported that 14-3-3 proteins are part of an abscisic acid viviparous-1 (VP1) response complex in the Em gene promoter, one of the late embryogenesis-abundant (LEA) proteins which affect maturing embryos, and interact with VP1 and Em-binding protein 1 (EmBP1) to control abscisic acid-responsive gene expression [6] and [31]. Three 14-3-3 isoforms, 14-3-3A, 14-3-3B and 14-3-3C, were induced in germinating barley embryos and their expression levels were all up-regulated by ABA [13] and [30]. In this study, we found that cDNA from the three Ta14S homoeologs share very high (95%) amino acid identities with a barley Hv14A amino acid sequence [32]. We hypothesized that the three homoeologs may be involved in regulation of seed development and germination processes. To test the hypothesis, we investigated their expression patterns in seed development and germination processes by qRT-PCR. All three homoeologs were expressed during the entire seed developmental process, and their mRNA abundances varied with the stage of seed development. Moreover, relatively high expression of all three genes was detected at 5 and 20 DAP, suggesting they may be involved in regulation of early seed development and later morphogenic processes. During germination all three homoeologous Ta14S genes were induced after seed imbibition but they were differentially expressed. Ta14S-2Aand Ta14S-2D showed a similar expression pattern during the entire germination process whereas expression of Ta14S-2B was clearly different in that it increased after 12 h of imbibition. This differential expression suggested different functions of the three homoeologs in germination.
Expression divergence between homoeologs in wheat was reported previously. For example, three TaEXPA1 homoeologs had similar genomic structures, but TaEXPA1-Bwas silenced [33]. Similarly, homoeologous sequences of methyl-binding domain proteins (TaMBD2) showed high conservation of nucleotide coding sequences and exon/intron structures, but the three TaMBD2 homoeologs were transcribed differentially in response to environmental stresses [34]. Epigenetic variation and promoter sequence are considered to affect the expressions of homoeologous genes [33] and [35]. However, the mechanistic details are still unclear. Obviously, further studies are required to determine whether Ta14S homoeologs have critical functions in regulating seed development in wheat.
Acknowledgments
This work was financially supported by the Key Transgenic Breeding Program of the Ministry of Agriculture of China (No. 2014ZX0800205B-003) and the National Natural Science Foundation of China (No. 30771332).
R. Brenchley, M. Spannagl, M. Pfeifer, G.L. Barker, R. Damore, A.M. Allen, N. McKenzie, M. Kramer, A. Kerhornou, D. Bolser, S. Kay, D. Waite, M. Trick, I. Bancroft, Y. Gu, N. Huo, M.C. Luo, S. Sehgal, B. Gill, S. Kianian, O. Anderson, P. Kersey, J. Dvorak, W.R. McCombie, A. Hall, K.F. Mayer, K.J. Edwards, M.W. Bevan, N. Hall
Analysis of the bread wheat genome using whole-genome shotgun sequencing
O.Y. Shoeva, E.K. Khlestkina, H. Berges, E.A. Salina
The homoeologous genes encoding chalcone-flavanone isomerase in Triticum aestivum L.: structural characterization and expression in different parts of wheat plants
No comments:
Post a Comment