Everything About Wood

Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.

Blog List

Wednesday, 29 June 2016

Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.)

Published Date
June 2016, Vol.4(3):188–198, doi:10.1016/j.cj.2016.03.002
Open Access, Creative Commons license, Funding information

Title 

Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.)

  • Author 
  • Xinguo Wang
  • Yanli Wang
  • Ruixia Xiao
  • Xin Chen
  • Jiangping Ren ,
  • National Wheat Engineering Research Center, Agricultural University of Henan, Zhengzhou 450002, China
Received 27 November 2015. Revised 3 March 2016. Accepted 15 March 2016. Available online 30 March 2016.

Abstract
The purpose of this study was to characterize Ta14S homoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of three Ta14S homoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated as Ta14S-2A, Ta14S-2B and Ta14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the three Ta14S genes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the three Ta14S genes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription of Ta14S-2B was clearly higher during seed germination, whereas expressions of Ta14S-2A and Ta14S-2D were up-regulated at the beginning of seed imbibition (0–12 h), but declined thereafter. The results suggested that the three Ta14S homoeologous genes have regulatory roles in seed development and germination.

Keywords
  • Common wheat
  • Gene expression
  • Homoeologous genes
  • Developmental regulation


  • 1 Introduction

    The 14-3-3 proteins are a family of highly conserved regulatory proteins found in virtually all eukaryotes. The N- and C-ends of these proteins are highly variable whereas the core structures are highly conserved [1]. These molecules are small acidic soluble proteins with a molecular mass of approximately 30 kDa. They usually form homo- and hetero-dimers to interact with diverse target proteins by specific phosphoserine/phosphothreonine-binding activity [2] and [3]. To date, there are over three hundred proteins identified as their interacting proteins [4] and [5], and the outcomes of binding are diverse, including alteration in conformation, subcellular localization and stabilization of the interacting proteins. They also mediate formation of protein complexes [6], [7], [8] and [9]. The physiological function of these proteins in plants has been the focus of considerable research. Various 14-3-3 isoforms have been isolated from diverse species including fifteen known protein isoforms in Arabidopsis [10], eight in rice [11], five in barley [12] and 7 potential isoforms in wheat [13], [14], [15], [16] and [17]. Plant 14-3-3 proteins can be divided into two classes, the epsilon and the non-epsilon groups, based on sequence similarity and phylogenetic analyses of sequences obtained from Arabidopsis [3]. Functional analysis revealed that increased or decreased expression of 14-3-3 protein genes caused a number of phenotypic, developmental and stress tolerance changes. For example, in rice plants transformed with an over-expression construct of the maize 14-3-3 protein gene, GF14–6, tolerance to drought stress and response to pathogen infection were changed [18]. When overexpressed in Arabidopsis plants wheat 14-3-3 protein caused shorter primary roots, delayed flowering and retarded growth rates [16]. The overexpression of cotton 14-3-3 protein Gh14-3-3 L promoted fiber elongation, leading to an increase in mature fiber length. By contrast, the suppression of the expression of Gh14-3-3 L, Gh14-3-3 e and Gh14-3-3 h in cotton slowed down fiber initiation and elongation [19]. These results indicated that some 14-3-3 protein-coding genes have roles in plant development and stress response.
    Wheat is a globally important crop, accounting for 20% of the calories consumed by humans [20]. Research that focuses on mechanisms of developmental regulation at the molecular level has potential to accelerate progress of wheat improvement. Although 14-3-3 proteins are increasingly implicated as key factors in developmental regulation [21], [22], [23] and [24], little is known about such genes in wheat seed development. Because hexaploid wheat contains three sets of chromosomes, Ta14-3-3 genes are likely to occur as homoeologous triplicates. Previously, we isolated a wheat cDNA designated as Ta14S with an open reading frame encoding a putative 14-3-3 protein [15]. To further clarify a regulatory function in wheat seed development, we isolated the genomic and cDNA sequences of Ta14S homoeologs in hexaploid wheat and located the genes to chromosomes using Chinese Spring nullisomic–tetrasomic lines. In addition, we analyzed their expression patterns in different tissues and at different seed developmental and germination stages.

    2 Materials and methods

    2.1 Plant sample preparation

    Common wheat (Triticum aestivum L.) cultivar (cv.) Luohan 2 was used for gene cloning and expression analysis. After being sterilized, seeds were germinated on moist filter paper in growth chambers at 25 °C under 12-h light/12-h dark conditions and transplanted into pots in a naturally lit glasshouse with normal irrigation and fertilization until mature. Dry seed embryos, primary roots and shoots at 1 day post-germination, roots and fully expanded leaves at 10 days post-germination, leaves at the tillering stage, stems at jointing, flag leaves, young panicles at heading, and developing seeds at 5, 10, 15, 20, 25, 30 and 35 DAP (days after pollination) were sampled. For germination treatment, mature seeds were surface-sterilized and then imbibed water from moist filter paper in Petri dishes in a temperature-controlled cultivation chamber (16 h photoperiod at 25 °C). Seeds were collected at 0, 6, 12, 24, 36 and 48 h after initiation of imbibition.
    All collected plant materials were frozen in liquid nitrogen immediately after collection and stored at − 80 °C until used. Three biologically independent replicates were assayed to ascertain reproducibility. A set of Chinese Spring (CS) nullisomic–tetrasomic lines, kindly provided by Dr. Xianchun Xia, Chinese Academy of Agricultural Sciences, was used to determine the chromosomal locations of Ta14S.

    2.2 DNA extraction, primer design, PCR and sequencing

    Genomic DNA was isolated from wheat seeds using a CTAB method [25]. Gene-specific primers were designed based on the sequence of Ta14S using Primer Premier 5.0 software (http://www.premierbiosoft.com/) and synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. (http://www.bgitechsolutions.cn/). PCR were performed in a Biametra-T3000 thermal cycler in total volumes of 20 μL, including 2 μL 10 × PCR buffer, 100 mmol L− 1 of each of dNTP, 5 pmol of each primer, 1 unit of Taq DNA polymerase (TIANGEN Biotech Co., Ltd., Beijing, http://www.tiangen.com/) and 100 ng of template DNA. Reaction conditions were 95 °C for 3 min followed by 35 cycles of 94 °C for 30 s, annealing at 55 °C for 1 min and 72 °C for 1–2 min, with a final extension at 72 °C for 10 min. PCR products were separated by electrophoresis in 1.0% agarose gels. Targeted fragments of expected size were recovered and cloned into the pMD18-T vector and sequenced by Beijing Liuhe Huada Gene Technology Co., Ltd. (http://www.bgitechsolutions.cn/). To ensure sequencing accuracy PCR and DNA sequencing were repeated at least three times.

    2.3 RNA extraction and first-strand cDNA synthesis

    Total RNA extractions from embryos and seeds were carried out using a hot-phenol method [26] and from leaves and roots using TRIzol Reagent (Invitrogen, Shanghai) according to the manufacturer's instructions. Quality and concentrations of total RNA were measured by spectrophotometer (NanoDrop ND-1000, Wilmington, USA) and agarose gel electrophoresis. Equal amounts (2 μg) of total RNA were transcribed into cDNA in a 20 μL reaction system containing 50 mmol L− 1 Tris–HCl (pH 8.3), 75 mmol L− 1 MgCl2, 10 mmol L− 1 DTT, 50 mmol L− 1 dNTPs, 200 U M-MLV reverse transcriptase (Promega, Madison, WI) and 50 pmol Oligo-dT15 anchor primer. Reverse transcription was performed for 60 min at 42 °C with a final denaturation step at 95 °C for 5 min.

    2.4 Rapid amplification of cDNA ends (RACE)

    mRNA was purified through oligotex chromatography (Clontech, Beijing) from total RNA and 3′-RACE and 5′-RACE were performed using a SMART-RACE cDNA amplification kit (Clontech, Beijing) according to the manufacturer's protocol. Gene-specific primers used for PCR were 3′-GSP (3′-RACE) and 5′-GSP (5′-RACE), respectively (Table 1). PCR was performed according to the manufacturer's protocol (Clontech). PCR conditions were 94 °C for 4 min, followed by 6 cycles of 94 °C for 30 s, 60 °C/58 °C for 30 s and 72 °C for 3 min, followed by 20 cycles of 94 °C for 30 s, 56 °C for 30 s, 72 °C for 3 min and finally 72 °C for 10 min. PCR products were separated by 1% agarose gel electrophoresis, and subcloned into the pMD18-T vector (TaKaRa, Dalian) and sequenced.
    Table 1. Primer sequences for gene cloning, RACE, chromosome location and real-time PCR.
    NamePrimer sequence (5′–3′)Notes
    Ta14S-FGAACTGTGAAGATGACGGCAFor amplifying gDNA and cDNA
    Ta14S-RAGCAGAACGAAAATACGAAC
    3′-GSPCGTGATAACTTGACCCTCTGGACTTC3′-RACE
    5′-GSPGGAAGACGGGACAAGGTGGGTTT5′-RACE
    Ta14S-F1ACGACTCAAGCGAGGGGCAFor 2D chromosome location and real time RT-PCR
    Ta14S-R1CGCCTGCTACGCTACAAGGAC
    Ta14S-F2GTCAATGACCGTTGCAATGTGFor 2B chromosome location and real time RT-PCR
    Ta14S-R2GCCACCACCACCACTGTATG
    Ta14S-F3GGAGGAGGAGATCAGGGAGGCTFor 2A chromosome location and real time RT-PCR
    Ta14S-R3TGCGACAACAACCATAACAGGG
    β-actin-FTTTGAAGAGTCGGTGAAGGGReal time RT-PCR
    β-actin-RTTTCATACAGCAGGCAAGCA

    2.5 Real-time quantitative RT-PCR

    Aliquots of 1 μg of total RNA were used for first-strand cDNA synthesis using a Primecript Reagent Kit with gDNA Eraser (Perfect real-time) according to the manufacturer's instructions (TaKaRa). Real-time quantitative RT-PCR was performed using an Eppendorf Realplex4 Mastercycler EP Gradient S machine (Eppendorf, Hamburg, Germany). Homoeologous Ta14S gene-specific primers were used for real-time quantitative PCR analysis. For normalization, the wheat β-actin gene (GenBank accession number: AB181991) was amplified as an endogenous control (Table 1).
    PCR was performed with the SYBR Green quantitative RT-PCR kit (TaKaRa) following the manufacturer's instructions. PCR cycling conditions comprised an initial cycle at 95 °C for 30 s, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 35 s and a final extension of 7 min at 72 °C. No-template negative controls (H2O control) were set up using gene-specific primer pairs, and no-RT-PCR controls were set up in duplicate using actin gene primers. Reactions were conducted in triplicate to ensure reproducibility of results.
    The cycle threshold (Ct), defined as the PCR cycle at which a statistically significant increase in reporter fluorescence is first detected, was used as a measure of the starting copy number of the target gene. Relative quantities of target gene expression levels were determined using the comparative Ct method. Relative quantification for each target gene was calculated by the 2− ΔΔCt method using β-actin as an internal reference gene for comparing data from different PCR runs or cDNA samples [27].

    3 Results

    3.1 Isolation of cDNA sequences of wheat Ta14S homoeologs

    To isolate the full-length cDNA sequence of the three wheat Ta14S homoeologs, the gene-specific primer pair Ta14S-F and Ta14S-R (Table 1) was designed according to the previously reported cDNA sequence of Ta14S (GB: JN650603) [15] in order to amplify the complete open reading frames (ORF) and cDNA from an immature seed mixture used as template. An approximate 1100 bp band was obtained; sequence alignment indicated that three different cDNA sequences were different, with lengths of 1052, 1056 and 1058 bp, and we temporarily named them as Ta14S-1, Ta14S-2and Ta14S-3, respectively. RACE was then performed to isolate the 5′ and 3′-end fragments with specific primers (Table 1). Agarose gel analysis showed three 5′-end fragments of about 598, 562, 484 bp and three 3′-end of fragments of about 387, 392 and 389 bp. According to the overlaps between the 5′- and 3′-end fragments and ORF sequences, three full-length cDNAs were obtained. As shown in Fig. 1, the full-length cDNAs of Ta14S-1, Ta14S-2 and Ta14S-3 were 1269, 1238 and 1156 bp, including the 189, 153 and 75 bp of 5′ UTR, 287, 292 and 289 bp of 3′ UTR, respectively. The ORF of the three homoeologous genes were 792 bp. The sequence identity of Ta14S-1, Ta14S-2 and Ta14S-3 was 91%. Compared with Ta14S-1, Ta14S-2has a 45 bp deletion and a 9 bp insertion in the 5′ UTR, and Ta14S-3 has a 23 bp and 101 bp deletion in the 5′ UTR. Ta14S-1, Ta14S-2 and Ta14S-3 have 3, 4 and 5 TGG repeats, respectively (Fig. 1). Although there were 22 single-base differences in the coding regions, amino acid sequences of the three genes were almost completely conserved except for residues Asp and Asn being changed to Gly and His at position 241 and 257, respectively (Fig. 2).
    Fig. 1. Nucleotide sequence alignments of the Ta14S genes (Ta14S-1, Ta14S-2 and Ta14S-3) amplified from genomic DNA and cDNA from wheat cv. Luohan No. 2. Exons and introns are shown in black and gray texts, respectively. Sequence identities and differences are shown in black and green shading, respectively. The positions of 5′ and 3′-UTR primers used for gene cloning and RACE are indicated by arrows. Different colored boxes indicate the positions of primers used for chromosome mapping. The red rectangular frames show the locations of the start (ATG) and stop (TAA) codons, respectively.
    Fig. 2. Alignment of amino acid sequences of the three Ta14S homoeologous genes. Sequence similarities and differences are shown in black and green texts, respectively.

    3.2 Gene structure and chromosomal locations of the wheat Ta14S homoeologs

    In order to better understand the genesis of the three Ta14S homoeologs, their genomic sequences were isolated with the specific primer pair Ta14S-F/Ta14S-R (Table 1). To correctly identify exon and intron segments of the three genes, we compared the genomic and corresponding cDNA sequences using DNAMAN software. As shown in Fig. 1, the three Ta14S homoeologous genes were composed of five exons and four introns. All exons and the first, second and fourth intron sequences of the three genes were relatively conserved, whereas the third introns had more frequent base substitutions and insertions/deletions. Compared with Ta14S-2 and Ta14S-3, Ta14S-1 had 9, 207 and 3 bp deletions in the third intron, respectively.
    To determine the chromosome locations of the Ta14S homoeologs in the wheat genome, specific primer pairs Ta14S-F1/R1, Ta14S-F2/R2 and Ta14S-F3/R3 (Table 1) were designed according to their 3′-end genomic sequences and tested on nulli-tetrasomic lines of Chinese Spring as template to amplify the corresponding genes in the A, B and D genomes. Homoeologous Ta14S genes Ta14S-1, Ta14S-2 and Ta14S-3were amplified in all nulli-tetrasomic lines except N2D-T2A, N2B-T2A and N2A-T2B (Fig. 3); Ta14S-1 amplified by primer pair Ta14S-F1/R1 was located on wheat chromosome 2D (Fig. 3a). Similarly, Ta14S-2 and Ta14S-3 amplified by primer pairs Ta14S-F2/R2 and Ta14S-F3/R3, respectively, were located on chromosomes 2B and 2A (Fig. 3b and c). Accordingly, Ta14S-1, Ta14S-2 and Ta14S-3 were renamed as Ta14S-2D, Ta14S-2B and Ta14S-2A, respectively.
    Fig. 3. Three homoeologous Ta14S genes were located using Chinese Spring (C.S.) and its nulli-tetrasomics lines. M: DNA ladder; a, b and c indicate that PCR products were specifically amplified with primer pairs Ta14S-F1/Ta14S-R1, Ta14S-F2/Ta14S-R2 and Ta14S-F3/Ta14S-R3.

    3.3 Phylogenetic analyses of the Ta14S homoeologs

    To determine the evolutionary relationship among the wheat 14-3-3 proteins and other plant species, 32 amino acid sequences from wheat, rice, barley and Arabidopsiswere aligned using Mega 6.0. An unrooted tree was constructed based on the alignment using the Neighbor-Joining method. As shown in Fig. 4, the tree was clearly divided into two distinct branches, non-epsilon (I) and epsilon (II). The non-epsilon group contained most of the proteins, whereas the epsilon group comprised only four proteins. The non-epsilon group can be further divided into two subgroups, each including both monocotyledonous and dicotyledonous species. Ta14S-2A, Ta14S-2B and Ta14S-2D appear to belong to the non-epsilon group and all closely resemble Hv14A. In addition, four other 14-3-3 proteins of barley (Hv14B, Hv14C, Hv14D and Hv14E) cluster in small sub-groups with five reported 14-3-3 proteins of wheat (Ta14A, Ta14R1, Ta14R2, Ta14Win2 and Ta14Win1), indicating that wheat and barley have a close phylogenetic relationship.
    Fig. 4. Phylogenetic analysis of Arabidopsis, rice, barley and wheat 14-3-3 proteins using the MEGA Neighbor-Joining program. GF14Chi, GF14Omega, GF14Psi, GF14Phi, GF14Upsilon, GF14Lambda, GF14Nu, GF14Kappa, GF14Mu, GF14Epsilon, GF14Omicron and GF14Iota are from Arabidopsis; Ta14A, Ta14B, TaR1, TaR2, TaWIN1, TaWIN2, Ta14S-2A, Ta14S-2B and Ta14S-2D are from wheat; Hv14A-E is from barley; and OsGF14A-F is from rice.

    3.4 Transcription profiling of the Ta14S homoeologs in different wheat tissues

    To define possible functions of the Ta14S homoeologs, we performed tissue-specific expression analyses of the three homoeologous Ta14S genes at different growth and developmental stages, including dry seed embryos, primary roots and shoots at 1 day post-germination, roots and fully expanded leaves at 10 days poat-germination, leaves at tillering, stems at jointing, flag leaves, young panicles at heading and immature seeds (Fig. 5a). The expression of all three Ta14S homoeologs was detected in all tissues examined, and all shared high expression levels in 1-day-old primary roots after germination. Moreover, the expressions of the three homoeologs changed with growth and developmental stages. They all showed high expression levels in early vegetative growth and decreased with seed maturity. Expression differences between the three homoeologs were also detected. For example, Ta14S-2B had relatively higher expression in 1-day-old roots and shoots, 10-day-old roots, leaves at tillering, and stems at jointing, whereas Ta14S-2D was highly expressed in 10-day-old fully expanded leaves.
    Fig. 5. Expression patterns of the three Ta14S homoeologous genes in wheat. (a) In different tissues. 1, dry seed embryos; 2, roots at 1 day post-germination; 3, shoots 1 day after germination; 4, roots at 10 days post-germination; 5, fully expanded leaves at 10 days post-germination; 6, leaves at tillering; 7, stems at jointing; 8, flag leaves at heading; 9, immature ears at heading; 10, seeds at 10 DAP; 11, seeds at 25 DAP. (b) During seed development stages. (c) During seed germination.

    3.5 Transcription profiling of the Ta14S homoeologs during seed development and seed germination

    Total RNA was extracted from immature and mature seeds, and qRT-PCR was performed to define the expression profiles of the three Ta14S homoeologs. The expression of the three Ta14S homoeologs during seed development showed fluctuating trends (Fig. 5b). All three shared highest expression levels at early stages of development (5 DAP), followed by decreased levels in the middle stages (10–15 DAP). Increases in transcription levels of all three genes were detected at 20 DAP, followed by decreases to minimum levels at 25 DAP. However, the three homoeologs showed different transcript abundances during seed development. For instance, Ta14S-2A was more highly expressed than Ta14S-2B and Ta14S-2D at 15, 20 and 35 DAP, but the expression levels of Ta14S-2A and Ta14S-2D at 30 DAP were lower than that of Ta14S-2B.
    The expression of the three Ta14S homoeologous genes during seed germination showed a gradually up-regulated trend at the beginning of seed imbibition (0–12 h) (Fig. 5c). Afterwards, significant differences in transcript were observed among the genes. The transcript levels of Ta14S-2A and Ta14S-2D showed a gradual downward trend at 24 and 36 h, and then increased at 48 h (Fig. 5c). By contrast, the transcription of Ta14S-2B was elevated in a time-dependent manner, and its transcript level was consistently higher than that of Ta14S-2A and Ta14S-2D during the entire seed germination process (Fig. 5c). These results indicate that all three homoeologs have a role in the seed germination process in wheat.

    4 Discussion

    The 14-3-3 proteins are phosphoserine-binding proteins that have vital roles in regulating a wide range of target proteins participating in diverse signal transduction and gene regulation, such as primary metabolism, plant development, protein trafficking, signal transduction and biotic/abiotic stress response [18], [19], [28] and [29]. Therefore, isolation and functional analysis of 14-3-3 genes are critical steps in understanding their regulatory roles. In order to study the functions of 14S orthologs encoding 14-3-3 proteins in wheat seed development, genomic DNA and cDNA sequences of one set of Ta14S homoeologs from hexaploid wheat were isolated and characterized. Sequence analysis revealed that the gene structures and numbers of amino acids were similar, but the three genes were distinguished by their 5′- and 3′-UTR. The three genes were located on group 2 chromosomes and named as a homoeologous set (Ta14S-2A, Ta14S-2B and Ta14S-2D). Phylogenetic analysis revealed that they are members of the non-epsilon group (I) of 14-3-3 proteins, sharing 50% to 100% identity with amino acid sequences in this group, which comprises more than 85% of plant 14-3-3 proteins. These results are in agreement with previous research [30].
    qRT-PCR assays demonstrated that all three Ta14S homoeologs were constitutively transcribed in various wheat organs at different developmental stages, including dry seed embryos, primary roots and shoots 1 day after germination, roots and fully expanded leaves 10 days after germination, leaves at tillering, stems at jointing, flag leaves and immature ears at heading, seeds at 10 and 25 days post-pollination. Moreover, mRNA abundances of the three genes also varied between tissues, and developmental stages. Interestingly, the three Ta14S homoeologous genes appeared to be highly expressed in primary roots 1 day post-germination, compared to other plant organs. It was reported that a wheat Ta14-3-3 gene in transgenic Arabidopsisplayed an important role during root development [16]. Collectively, it can be concluded that the high expression of all three Ta14S homoeologs in young roots may regulate initial elongation of the radical and affect root development.
    Earlier studies showed that 14-3-3 proteins are involved in signal transduction pathways with roles in late embryo development in seeds and germination. It was reported that 14-3-3 proteins are part of an abscisic acid viviparous-1 (VP1) response complex in the Em gene promoter, one of the late embryogenesis-abundant (LEA) proteins which affect maturing embryos, and interact with VP1 and Em-binding protein 1 (EmBP1) to control abscisic acid-responsive gene expression [6] and [31]. Three 14-3-3 isoforms, 14-3-3A, 14-3-3B and 14-3-3C, were induced in germinating barley embryos and their expression levels were all up-regulated by ABA [13] and [30]. In this study, we found that cDNA from the three Ta14S homoeologs share very high (95%) amino acid identities with a barley Hv14A amino acid sequence [32]. We hypothesized that the three homoeologs may be involved in regulation of seed development and germination processes. To test the hypothesis, we investigated their expression patterns in seed development and germination processes by qRT-PCR. All three homoeologs were expressed during the entire seed developmental process, and their mRNA abundances varied with the stage of seed development. Moreover, relatively high expression of all three genes was detected at 5 and 20 DAP, suggesting they may be involved in regulation of early seed development and later morphogenic processes. During germination all three homoeologous Ta14S genes were induced after seed imbibition but they were differentially expressed. Ta14S-2Aand Ta14S-2D showed a similar expression pattern during the entire germination process whereas expression of Ta14S-2B was clearly different in that it increased after 12 h of imbibition. This differential expression suggested different functions of the three homoeologs in germination.
    Expression divergence between homoeologs in wheat was reported previously. For example, three TaEXPA1 homoeologs had similar genomic structures, but TaEXPA1-Bwas silenced [33]. Similarly, homoeologous sequences of methyl-binding domain proteins (TaMBD2) showed high conservation of nucleotide coding sequences and exon/intron structures, but the three TaMBD2 homoeologs were transcribed differentially in response to environmental stresses [34]. Epigenetic variation and promoter sequence are considered to affect the expressions of homoeologous genes [33] and [35]. However, the mechanistic details are still unclear. Obviously, further studies are required to determine whether Ta14S homoeologs have critical functions in regulating seed development in wheat.

    Acknowledgments

    This work was financially supported by the Key Transgenic Breeding Program of the Ministry of Agriculture of China (No. 2014ZX0800205B-003) and the National Natural Science Foundation of China (No. 30771332).

    References

      • [1]
      • F.C. Denison, A.L. Paul, A.K. Zupanska, R.J. Ferl
      • 14-3-3 proteins in plant physiology
      • Semin. Cell Dev. Biol., Volume 22, 2011, pp. 720–727
      • Article
         | 
         PDF (529 K)
         | 
        View Record in Scopus
        Citing articles (77)
      • [2]
      • D.H. Jones, S. Ley, A. Aitken
      • Isoforms of 14-3-3 protein can form homo- and heterodimers in vivo and in vitro: implications for function as adapter proteins
      • FEBS Lett., Volume 368, 1995, pp. 55–58
      • Article
         | 
         PDF (522 K)
         | 
        View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (161)
      • [3]
      • A.H. de Boer, P.J. van Kleeff, J. Gao
      • Plant 14-3-3 proteins as spiders in a web of phosphorylation
      • Protoplasma, Volume 250, 2013, pp. 425–440
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (24)
      • [4]
      • P.J. Schoonheim, H. Veiga, D.C. Pereira, G. Friso, K.J. van Wijk, A.H. de Boer
      • A comprehensive analysis of the 14-3-3 interactome in barley leaves using a complementary proteomics and two-hybrid approach
      • Plant Physiol., Volume 143, 2007, pp. 670–683
      • View Record in Scopus
        Citing articles (64)
      • [5]
      • I.F. Chang, A. Curran, R. Woolsey, D. Quilici, J.C. Cushman, R. Mittler, A. Harmon, J.F. Harper
      • Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana
      • Proteomics, Volume 9, 2009, pp. 2967–2985
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (99)
      • [6]
      • T.F. Schultz, J. Medina, A. Hill, R.S. Quatrano
      • 14-3-3 proteins are part of an abscisic acid VIVIPAROUS1 (VP1) response complex in the Em promoter and interact with VP1 and EmBP1
      • Plant Cell, Volume 10, 1998, pp. 837–848
      • Full Text via CrossRef
      • [7]
      • D. Igarashi, S. Ishida, J. Fukazawa, Y. Takahashi
      • 14-3-3 proteins regulate intracellular localization of the bZIP transcriptional activator RSG
      • Plant Cell, Volume 13, 2001, pp. 2483–2497
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (122)
      • [8]
      • T. Gokirmak, A.L. Paul, R.J. Ferl
      • Plant phosphopeptide binding proteins as signaling mediators
      • Curr. Opin. Plant Biol., Volume 13, 2010, pp. 527–532
      • Article
         | 
         PDF (216 K)
         | 
        View Record in Scopus
        Citing articles (29)
      • [9]
      • J.C. Chi, J. Roeper, G. Schwarz, K. Fischer-Schrader
      • Dual binding of 14-3-3 protein regulates Arabidopsis nitrate reductase activity
      • J. Biol. Inorg. Chem., Volume 20, 2015, pp. 277–286
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (2)
      • [10]
      • P.C. Sehnke, M. Rosenquist, M. Alsterfjord, J. Delille, M. Sommarin, C. Larsson, R.J. Ferl
      • Evolution and isoform specificity of plant 14-3-3 proteins
      • Plant Mol. Biol., Volume 50, 2002, pp. 1011–1018
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (55)
      • [11]
      • Y. Yao, Y. Du, L. Jiang, J.Y. Liu
      • Molecular analysis and expression patterns of the 14-3-3 gene family from Oryza sativa
      • J. Biochem. Mol. Biol., Volume 40, 2007, pp. 349–357
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (32)
      • [12]
      • P.J. Schoonheim, M.P. Sinnige, J.A. Casaretto, H. Veiga, T.D. Bunney, R.S. Quatrano, A.H. de Boer
      • 14-3-3 adaptor proteins are intermediates in ABA signal transduction during barley seed germination
      • Plant J., Volume 49, 2007, pp. 289–301
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (58)
      • [13]
      • Y. Ikeda, N. Koizume, T. Kusano, H. Sano
      • Specific binding of a 14-3-3 protein to autophosphorylated WPK4, an SNF1-related wheat protein kinase, and to WPK4-phosphorylated nitrate reductase
      • J. Biol. Chem., Volume 275, 2000, pp. 31695–31700
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (54)
      • [14]
      • C. Wang, Q.H. Ma, Z.B. Lin, P. He, J.Y. Liu
      • Cloning and characterization of a cDNA encoding 14-3-3 protein with leaf and stem-specific expression from wheat
      • DNA Seq., Volume 19, 2008, pp. 130–136
      • Article
         | 
         PDF (745 K)
         | 
        View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (11)
      • [15]
      • J.P. Ren, H.L. Liu, X.G. Wang, H.B. Niu, Y.C. Li, X. Wang, X. Chen, J. Yin
      • Cloning and expression analysis of a stress-related Ta14S gene from wheat
      • Sci. Agric. Sin., Volume 45, 2012, pp. 1226–1234 (in Chinese with English abstract)
      • [16]
      • J. Li, S.S. Song, Y.S. Zhao, W.W. Guo, G.H. Guo, H.R. Peng, Z.F. Ni, Q.X. Sun, Y.Y. Yao
      • Wheat 14-3-3 protein conferring growth retardation in Arabidopsis
      • J. Integr. Agric., Volume 12, 2013, pp. 209–217
      • Article
         | 
         PDF (1273 K)
         | 
        View Record in Scopus
        Citing articles (2)
      • [17]
      • X.D. Meng, X. Chen, Y.Y. Wang, R.X. Xiao, H.L. Liu, X.G. Wang, J.P. Ren, Y.C. Li, H.B. Niu, X. Wang, J. Yin
      • Characterization and subcellular localization of two 14-3-3 genes and their response to abiotic stress in wheat
      • Chin. J. Biotechnol., Volume 30, 2014, pp. 232–246
      • View Record in Scopus
      • [18]
      • S. Campo, C.P. Peris, L. Montesinos, G. Penas, J. Messeguer, B.S. Segundo
      • Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection
      • J. Exp. Bot., Volume 63, 2012, pp. 983–999
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (30)
      • [19]
      • Y. Zhou, Z.T. Zhang, M. Li, X.Z. Wei, X.J. Li, B.Y. Li, X.B. Li
      • Cotton (Gossypium hirsutum) 14-3-3 proteins participate in regulation of fibre initiation and elongation by modulating brassinosteroid signaling
      • Plant Biotechnol. J., Volume 13, 2015, pp. 269–280
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1)
      • [20]
      • R. Brenchley, M. Spannagl, M. Pfeifer, G.L. Barker, R. Damore, A.M. Allen, N. McKenzie, M. Kramer, A. Kerhornou, D. Bolser, S. Kay, D. Waite, M. Trick, I. Bancroft, Y. Gu, N. Huo, M.C. Luo, S. Sehgal, B. Gill, S. Kianian, O. Anderson, P. Kersey, J. Dvorak, W.R. McCombie, A. Hall, K.F. Mayer, K.J. Edwards, M.W. Bevan, N. Hall
      • Analysis of the bread wheat genome using whole-genome shotgun sequencing
      • Nature, Volume 491, 2012, pp. 705–710
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (358)
      • [21]
      • J.D. Mayfield, A.L. Paul, R.J. Ferl
      • The 14-3-3 proteins of Arabidopsis regulate root growth and chloroplast development as components of the photosensory system
      • J. Exp. Bot., Volume 63, 2012, pp. 3061–3070
      • View Record in Scopus
        Citing articles (17)
      • [22]
      • P.J. van Kleeff, N. Jaspert, K.W. Li, S. Rauch, C. Oecking, A.H. de Boer
      • Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions
      • J. Exp. Bot., Volume 65, 2014, pp. 5877–5888
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (7)
      • [23]
      • H. Shi, Y. Zhang
      • Pear 14-3-3a gene (Pp14-3-3a) is regulated during fruit ripening and senescence, and involved in response to salicylic acid and ethylene signaling
      • J. Genet., Volume 93, 2014, pp. 747–753
      • View Record in Scopus
         | 
        Full Text via CrossRef
      • [24]
      • Y. Dou, X. Liu, Y. Yin, S. Han, Y. Lu, Y. Liu, D. Hao
      • Affinity chromatography revealed insights into unique functionality of two 14-3-3 protein species in developing maize kernels
      • J. Proteomics, Volume 114, 2015, pp. 274–286
      • Article
         | 
         PDF (1245 K)
         | 
        View Record in Scopus
        Citing articles (1)
      • [25]
      • G.L. Wang, H.J. Fang
      • Plant Genetic Engineering Principle and Technology
      • 1998, Science Press, Beijing
      • [26]
      • T.C. Verwoerd, B.M.M. Dekker, A. Hoekema
      • A small-scale procedure for the rapid isolation of plant RNAs
      • Nucleic Acids Res., Volume 17, 1989, p. 2362
      • View Record in Scopus
        Citing articles (1102)
      • [27]
      • K.J. Livak, T.D. Schmittgen
      • Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCt method
      • Methods, Volume 25, 2001, pp. 402–408
      • Article
         | 
         PDF (700 K)
         | 
        View Record in Scopus
        Citing articles (44130)
      • [28]
      • M.R. Roberts, J. Salinas, D.B. Collinge
      • 14-3-3 proteins and the response to abiotic and biotic stress
      • Plant Mol. Biol., Volume 50, 2002, pp. 1031–1039
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (116)
      • [29]
      • D. Bridges, G.B.G. Moorhead
      • 14-3-3 proteins: a number of functions for a numbered protein
      • Sci. STKE, Volume 242, 2004, p. re10
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (76)
      • [30]
      • C. Testerink, R.M. van der Meulen, B.J. Oppedijk, A.H. de Boer, S. Heimovaara-Dijkstra, J.W. Kijne, M. Wang
      • Differences in spatial expression between 14-3-3 isoforms in germinating barley embryos
      • Plant Physiol., Volume 121, 1999, pp. 81–87
      • View Record in Scopus
        Citing articles (45)
      • [31]
      • F. del Viso, J.A. Casaretto, R.S. Quatrano
      • 14-3-3 proteins are components of the transcription complex of the ATEM 1promoter in Arabidopsis
      • Planta, Volume 227, 2007, pp. 167–175
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (9)
      • [32]
      • J. Brandt, H. Thordal-Christensen, K. Vad, P.L. Gregersen, D.B. Collinge
      • A pathogen-induced gene of barley encodes a protein showing high similarity to a protein kinase regulator
      • Plant J., Volume 2, 1992, pp. 815–820
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (106)
      • [33]
      • Z.R. Hu, Z.F. Han, N. Song, L.L. Chai, Y.Y. Yao, H.R. Peng, Z.F. Ni, Q.X. Sun
      • Epigenetic modification contributes to the expression divergence of three TaEXPA1 homoeologs in hexaploid wheat (Triticum aestivum)
      • New Phytol., Volume 197, 2013, pp. 1344–1352
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (15)
      • [34]
      • Z.R. Hu, Y. Yu, R. Wang, Y.Y. Yao, H.R. Peng, Z.F. Ni, Q.X. Sun
      • Expression divergence of TaMBD2 homoeologous genes encoding methyl CpG-binding domain proteins in wheat (Triticum aestivum L.)
      • Gene, Volume 471, 2011, pp. 13–18
      • Article
         | 
         PDF (614 K)
         | 
        View Record in Scopus
        Citing articles (9)
      • [35]
      • O.Y. Shoeva, E.K. Khlestkina, H. Berges, E.A. Salina
      • The homoeologous genes encoding chalcone-flavanone isomerase in Triticum aestivum L.: structural characterization and expression in different parts of wheat plants
      • Gene, Volume 538, 2014, pp. 334–341
      • Article
         | 
         PDF (597 K)
         | 
        View Record in Scopus
        Citing articles (9)
    • ⁎ 
      Corresponding author.


    For further details log on website :
    http://www.sciencedirect.com/science/article/pii/S2214514116300204
    at June 29, 2016
    Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest

    No comments:

    Post a Comment

    Newer Post Older Post Home
    Subscribe to: Post Comments (Atom)

    Advantages and Disadvantages of Fasting for Runners

    Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...

    • Pengalaman bekerja sebagai kerani kilang.
      Assalamualaikum dan salam sejahtera chu olls.     Alhamdulillah sudah seminggu saya melalui pengalaman bermakna ini. Sebagai seorang pel...
    • MIDA- INDUSTRI BERASASKAN KAYU
      Industri berasaskan kayu di Malaysia terdiri daripada  Kayu bergergaji; Venir dan produk panel yang termasuk papan lapis dan produk ...
    • Advantages and Disadvantages of Fasting for Runners
      Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...
    • UKIRAN KAYU DALAM MASYARAKAT MELAYU
      Seni ukiran kayu di kalangan masyarakat Melayu bukan sahaja terdapat pada rumah-rumah tetapi penjelmaan dan penerapannya terdapat pada is...
    • Laboratory Assessment of Forest Soil Respiration Affected by Wildfires under Various Environments of Russia
      International Journal of Ecology Volume 2017 (2017), Article ID 3985631, 10 pages https://doi.org/10.1155/2017/3985631 Author Evgeny  ...
    • Diploma Teknologi Berasaskan Kayu
      LATARBELAKANG POLITEKNIK KOTA KINABALU Politeknik Kota Kinabalu merupakan politeknik yang ketujuh ditubuhkan oleh Kementerian Pendidikan...
    • DIPLOMA REKA BENTUK PERABUT
      Sijil Teknologi Diploma Rekabentuk Perabot Kod Kursus :  K18 ...
    • Motif, Corak dan Ragi Tenun Melayu Riau
      Author MELAYU Riau kaya dengan khazanah budayanya. Antaranya yang amat menonjol adalah motif ornamen Melayunya, yang banyak dipakai untuk ...
    • RUBBER AND PVC FETISHISM
      Rubber fetishism , or  latex fetishism , is the fetishistic attraction to people wearing latex clothing or, in certain cases, to the garme...
    • 5 Jenama Foundation Terbaik, Beli Di Farmasi Je!
      Beberapa minggu sudah, penulis pernah mencadangkan beberapa jenama maskara terbaik yang mudah didapati pada harga berpatutan dari farmas...

    nuffnang ads

    Search This Blog

    Pages

    • Home

    About Me

    Unknown
    View my complete profile

    Blog Archive

    • ►  2018 (371)
      • ►  June (17)
        • ►  Jun 22 (8)
        • ►  Jun 12 (1)
        • ►  Jun 11 (2)
        • ►  Jun 05 (6)
      • ►  May (6)
        • ►  May 31 (6)
      • ►  April (75)
        • ►  Apr 30 (1)
        • ►  Apr 27 (1)
        • ►  Apr 26 (15)
        • ►  Apr 25 (10)
        • ►  Apr 24 (11)
        • ►  Apr 18 (2)
        • ►  Apr 12 (4)
        • ►  Apr 10 (5)
        • ►  Apr 09 (9)
        • ►  Apr 05 (17)
      • ►  March (65)
        • ►  Mar 27 (7)
        • ►  Mar 22 (2)
        • ►  Mar 20 (4)
        • ►  Mar 13 (14)
        • ►  Mar 12 (11)
        • ►  Mar 08 (7)
        • ►  Mar 06 (1)
        • ►  Mar 05 (1)
        • ►  Mar 01 (18)
      • ►  February (103)
        • ►  Feb 28 (25)
        • ►  Feb 27 (27)
        • ►  Feb 26 (10)
        • ►  Feb 20 (1)
        • ►  Feb 19 (9)
        • ►  Feb 09 (13)
        • ►  Feb 06 (6)
        • ►  Feb 05 (5)
        • ►  Feb 02 (7)
      • ►  January (105)
        • ►  Jan 25 (11)
        • ►  Jan 23 (5)
        • ►  Jan 16 (6)
        • ►  Jan 15 (9)
        • ►  Jan 14 (7)
        • ►  Jan 10 (1)
        • ►  Jan 09 (2)
        • ►  Jan 08 (4)
        • ►  Jan 04 (24)
        • ►  Jan 03 (2)
        • ►  Jan 02 (21)
        • ►  Jan 01 (13)
    • ►  2017 (6160)
      • ►  December (11)
        • ►  Dec 30 (11)
      • ►  November (31)
        • ►  Nov 26 (9)
        • ►  Nov 07 (8)
        • ►  Nov 06 (3)
        • ►  Nov 01 (11)
      • ►  October (345)
        • ►  Oct 31 (4)
        • ►  Oct 25 (42)
        • ►  Oct 24 (5)
        • ►  Oct 23 (15)
        • ►  Oct 22 (3)
        • ►  Oct 18 (7)
        • ►  Oct 17 (27)
        • ►  Oct 16 (14)
        • ►  Oct 15 (6)
        • ►  Oct 13 (18)
        • ►  Oct 12 (44)
        • ►  Oct 11 (57)
        • ►  Oct 09 (47)
        • ►  Oct 06 (14)
        • ►  Oct 05 (1)
        • ►  Oct 04 (13)
        • ►  Oct 03 (17)
        • ►  Oct 02 (11)
      • ►  September (186)
        • ►  Sept 29 (3)
        • ►  Sept 26 (7)
        • ►  Sept 25 (18)
        • ►  Sept 21 (29)
        • ►  Sept 20 (10)
        • ►  Sept 19 (11)
        • ►  Sept 18 (2)
        • ►  Sept 14 (19)
        • ►  Sept 13 (28)
        • ►  Sept 11 (3)
        • ►  Sept 10 (15)
        • ►  Sept 08 (5)
        • ►  Sept 06 (22)
        • ►  Sept 05 (14)
      • ►  August (158)
        • ►  Aug 29 (10)
        • ►  Aug 28 (73)
        • ►  Aug 27 (2)
        • ►  Aug 21 (4)
        • ►  Aug 18 (17)
        • ►  Aug 17 (4)
        • ►  Aug 14 (13)
        • ►  Aug 11 (5)
        • ►  Aug 10 (4)
        • ►  Aug 09 (7)
        • ►  Aug 08 (1)
        • ►  Aug 06 (3)
        • ►  Aug 04 (2)
        • ►  Aug 03 (13)
      • ►  July (290)
        • ►  Jul 26 (9)
        • ►  Jul 25 (7)
        • ►  Jul 24 (25)
        • ►  Jul 23 (5)
        • ►  Jul 21 (13)
        • ►  Jul 18 (19)
        • ►  Jul 17 (18)
        • ►  Jul 14 (17)
        • ►  Jul 13 (75)
        • ►  Jul 12 (10)
        • ►  Jul 11 (64)
        • ►  Jul 10 (26)
        • ►  Jul 09 (2)
      • ►  June (522)
        • ►  Jun 30 (1)
        • ►  Jun 27 (3)
        • ►  Jun 22 (13)
        • ►  Jun 21 (41)
        • ►  Jun 20 (3)
        • ►  Jun 19 (68)
        • ►  Jun 16 (33)
        • ►  Jun 15 (87)
        • ►  Jun 13 (25)
        • ►  Jun 12 (26)
        • ►  Jun 09 (20)
        • ►  Jun 08 (60)
        • ►  Jun 07 (54)
        • ►  Jun 06 (53)
        • ►  Jun 05 (35)
      • ►  May (684)
        • ►  May 31 (6)
        • ►  May 22 (3)
        • ►  May 21 (14)
        • ►  May 20 (12)
        • ►  May 19 (3)
        • ►  May 18 (26)
        • ►  May 17 (63)
        • ►  May 16 (27)
        • ►  May 15 (25)
        • ►  May 14 (16)
        • ►  May 07 (9)
        • ►  May 06 (26)
        • ►  May 05 (74)
        • ►  May 04 (126)
        • ►  May 03 (51)
        • ►  May 02 (153)
        • ►  May 01 (50)
      • ►  April (759)
        • ►  Apr 29 (56)
        • ►  Apr 28 (37)
        • ►  Apr 27 (67)
        • ►  Apr 26 (87)
        • ►  Apr 25 (6)
        • ►  Apr 10 (4)
        • ►  Apr 09 (5)
        • ►  Apr 08 (78)
        • ►  Apr 07 (57)
        • ►  Apr 06 (52)
        • ►  Apr 05 (53)
        • ►  Apr 04 (43)
        • ►  Apr 03 (94)
        • ►  Apr 02 (28)
        • ►  Apr 01 (92)
      • ►  March (1744)
        • ►  Mar 31 (90)
        • ►  Mar 30 (74)
        • ►  Mar 29 (58)
        • ►  Mar 28 (50)
        • ►  Mar 27 (95)
        • ►  Mar 26 (58)
        • ►  Mar 25 (98)
        • ►  Mar 24 (94)
        • ►  Mar 23 (77)
        • ►  Mar 22 (43)
        • ►  Mar 21 (54)
        • ►  Mar 20 (43)
        • ►  Mar 19 (88)
        • ►  Mar 18 (65)
        • ►  Mar 17 (63)
        • ►  Mar 16 (94)
        • ►  Mar 15 (79)
        • ►  Mar 14 (35)
        • ►  Mar 11 (10)
        • ►  Mar 10 (43)
        • ►  Mar 09 (40)
        • ►  Mar 08 (27)
        • ►  Mar 07 (40)
        • ►  Mar 06 (62)
        • ►  Mar 05 (48)
        • ►  Mar 04 (63)
        • ►  Mar 03 (54)
        • ►  Mar 02 (13)
        • ►  Mar 01 (86)
      • ►  February (715)
        • ►  Feb 28 (10)
        • ►  Feb 27 (61)
        • ►  Feb 26 (31)
        • ►  Feb 24 (22)
        • ►  Feb 23 (31)
        • ►  Feb 22 (42)
        • ►  Feb 21 (30)
        • ►  Feb 20 (42)
        • ►  Feb 19 (43)
        • ►  Feb 18 (46)
        • ►  Feb 17 (39)
        • ►  Feb 16 (39)
        • ►  Feb 15 (24)
        • ►  Feb 14 (54)
        • ►  Feb 13 (25)
        • ►  Feb 12 (78)
        • ►  Feb 10 (53)
        • ►  Feb 09 (22)
        • ►  Feb 01 (23)
      • ►  January (715)
        • ►  Jan 30 (25)
        • ►  Jan 28 (19)
        • ►  Jan 27 (36)
        • ►  Jan 26 (27)
        • ►  Jan 24 (27)
        • ►  Jan 22 (22)
        • ►  Jan 21 (58)
        • ►  Jan 20 (20)
        • ►  Jan 19 (30)
        • ►  Jan 18 (39)
        • ►  Jan 17 (26)
        • ►  Jan 16 (36)
        • ►  Jan 15 (62)
        • ►  Jan 14 (22)
        • ►  Jan 13 (20)
        • ►  Jan 12 (33)
        • ►  Jan 11 (32)
        • ►  Jan 10 (26)
        • ►  Jan 05 (11)
        • ►  Jan 04 (22)
        • ►  Jan 03 (35)
        • ►  Jan 02 (34)
        • ►  Jan 01 (53)
    • ▼  2016 (6885)
      • ►  December (986)
        • ►  Dec 31 (12)
        • ►  Dec 30 (23)
        • ►  Dec 29 (15)
        • ►  Dec 28 (29)
        • ►  Dec 27 (32)
        • ►  Dec 26 (29)
        • ►  Dec 25 (39)
        • ►  Dec 24 (43)
        • ►  Dec 23 (29)
        • ►  Dec 22 (28)
        • ►  Dec 21 (46)
        • ►  Dec 20 (28)
        • ►  Dec 19 (36)
        • ►  Dec 18 (14)
        • ►  Dec 17 (24)
        • ►  Dec 16 (10)
        • ►  Dec 15 (43)
        • ►  Dec 14 (55)
        • ►  Dec 13 (38)
        • ►  Dec 12 (45)
        • ►  Dec 11 (26)
        • ►  Dec 10 (48)
        • ►  Dec 09 (34)
        • ►  Dec 08 (22)
        • ►  Dec 07 (29)
        • ►  Dec 06 (15)
        • ►  Dec 05 (45)
        • ►  Dec 04 (38)
        • ►  Dec 03 (41)
        • ►  Dec 02 (41)
        • ►  Dec 01 (29)
      • ►  November (600)
        • ►  Nov 30 (38)
        • ►  Nov 29 (36)
        • ►  Nov 28 (43)
        • ►  Nov 27 (22)
        • ►  Nov 26 (27)
        • ►  Nov 25 (39)
        • ►  Nov 24 (27)
        • ►  Nov 23 (37)
        • ►  Nov 22 (21)
        • ►  Nov 21 (32)
        • ►  Nov 20 (20)
        • ►  Nov 19 (31)
        • ►  Nov 18 (34)
        • ►  Nov 17 (29)
        • ►  Nov 16 (21)
        • ►  Nov 15 (33)
        • ►  Nov 14 (16)
        • ►  Nov 13 (3)
        • ►  Nov 12 (3)
        • ►  Nov 11 (1)
        • ►  Nov 09 (2)
        • ►  Nov 07 (14)
        • ►  Nov 04 (16)
        • ►  Nov 03 (17)
        • ►  Nov 02 (23)
        • ►  Nov 01 (15)
      • ►  October (374)
        • ►  Oct 31 (15)
        • ►  Oct 30 (2)
        • ►  Oct 29 (4)
        • ►  Oct 28 (25)
        • ►  Oct 27 (19)
        • ►  Oct 26 (16)
        • ►  Oct 25 (11)
        • ►  Oct 24 (14)
        • ►  Oct 23 (12)
        • ►  Oct 21 (14)
        • ►  Oct 20 (19)
        • ►  Oct 19 (21)
        • ►  Oct 18 (17)
        • ►  Oct 17 (15)
        • ►  Oct 16 (20)
        • ►  Oct 15 (12)
        • ►  Oct 14 (11)
        • ►  Oct 13 (21)
        • ►  Oct 12 (13)
        • ►  Oct 11 (6)
        • ►  Oct 10 (12)
        • ►  Oct 09 (17)
        • ►  Oct 08 (10)
        • ►  Oct 07 (11)
        • ►  Oct 06 (19)
        • ►  Oct 05 (13)
        • ►  Oct 03 (5)
      • ►  September (406)
        • ►  Sept 29 (6)
        • ►  Sept 28 (2)
        • ►  Sept 27 (12)
        • ►  Sept 16 (20)
        • ►  Sept 15 (34)
        • ►  Sept 14 (39)
        • ►  Sept 13 (32)
        • ►  Sept 12 (36)
        • ►  Sept 11 (18)
        • ►  Sept 10 (16)
        • ►  Sept 07 (6)
        • ►  Sept 06 (26)
        • ►  Sept 05 (14)
        • ►  Sept 04 (44)
        • ►  Sept 03 (17)
        • ►  Sept 02 (38)
        • ►  Sept 01 (46)
      • ►  August (777)
        • ►  Aug 31 (13)
        • ►  Aug 29 (22)
        • ►  Aug 28 (13)
        • ►  Aug 27 (26)
        • ►  Aug 26 (18)
        • ►  Aug 25 (14)
        • ►  Aug 24 (13)
        • ►  Aug 23 (22)
        • ►  Aug 22 (23)
        • ►  Aug 21 (20)
        • ►  Aug 20 (23)
        • ►  Aug 19 (13)
        • ►  Aug 18 (31)
        • ►  Aug 17 (36)
        • ►  Aug 16 (17)
        • ►  Aug 15 (33)
        • ►  Aug 14 (24)
        • ►  Aug 13 (28)
        • ►  Aug 12 (28)
        • ►  Aug 11 (28)
        • ►  Aug 10 (59)
        • ►  Aug 09 (33)
        • ►  Aug 08 (39)
        • ►  Aug 07 (23)
        • ►  Aug 06 (36)
        • ►  Aug 05 (23)
        • ►  Aug 04 (25)
        • ►  Aug 03 (17)
        • ►  Aug 02 (26)
        • ►  Aug 01 (51)
      • ►  July (890)
        • ►  Jul 31 (27)
        • ►  Jul 30 (31)
        • ►  Jul 29 (29)
        • ►  Jul 28 (40)
        • ►  Jul 27 (32)
        • ►  Jul 26 (16)
        • ►  Jul 25 (5)
        • ►  Jul 24 (45)
        • ►  Jul 23 (16)
        • ►  Jul 22 (42)
        • ►  Jul 21 (11)
        • ►  Jul 20 (41)
        • ►  Jul 19 (31)
        • ►  Jul 18 (35)
        • ►  Jul 17 (41)
        • ►  Jul 16 (21)
        • ►  Jul 15 (23)
        • ►  Jul 14 (38)
        • ►  Jul 13 (49)
        • ►  Jul 12 (42)
        • ►  Jul 11 (25)
        • ►  Jul 10 (48)
        • ►  Jul 09 (33)
        • ►  Jul 08 (38)
        • ►  Jul 07 (19)
        • ►  Jul 06 (10)
        • ►  Jul 05 (14)
        • ►  Jul 04 (13)
        • ►  Jul 03 (20)
        • ►  Jul 02 (26)
        • ►  Jul 01 (29)
      • ▼  June (1003)
        • ►  Jun 30 (29)
        • ▼  Jun 29 (43)
          • New 'Artificial Synapses' Could Let Supercomputers...
          • Gluten Triggers Strange Delusions in Woman with Ce...
          • Cold-setting starch adhesive
          • Estimation of biomass in wheat using random forest...
          • Ethylene response factor BnERF2-like (ERF2.4) from...
          • What Is Turmeric & Where Do You Get It?
          • Intermittent Fasting & Bodybuilding
          • What Are the Causes of Stress Among College Sudents?
          • A List of the Benefits of Cardiovascular Endurance
          • The Abs Diet for Breakfast
          • FARM
          • ENERGY CROP
          • CROP-LIEN SYSTEM
          • CROP YIELD
          • CROP WILD RELATIVE
          • How to Take Vitamin B-12 at Night
          • Does Going to Sleep Earlier Make You Feel Better?
          • Genius: Can Anybody Be One?
          • 'First Night' Insomnia: Why You Don't Sleep Well i...
          • Structure and linear viscoelasticity of polymer na...
          • Silica encapsulation by miniemulsion polymerizatio...
          • Delayed gelling starch compositions
          • SHEAR THICKENING PREGELATINIZED STARCH
          • Molecular characterization and expression analysis...
          • Metabolite variation in hybrid corn grain from a l...
          • How Much Curcumin Is There in Powdered Turmeric?
          • Recommended Dosages for Turmeric
          • What Are the Benefits of Turmeric Capsules?
          • Human Brain: Facts, Functions & Anatomy
          • Why You Forget: 5 Strange Facts About Memory
          • Brains of Introverts Reveal Why They Prefer Being ...
          • CROP WEED
          • CROP RESIDUE
          • CROP DIVERSITY
          • CROP DESTRUCTION
          • COVER CROP
          • CATCH CROP
          • BUMPER CROP
          • KHARIF CROP
          • Phytohormones and their metabolic engineering for ...
          • SHEAR THICKENING PREGELATINIZED STARCH
          • Processable conductive graphene/polyethylene nanoc...
          • Meditation Techniques for Teens
        • ►  Jun 28 (27)
        • ►  Jun 27 (33)
        • ►  Jun 26 (49)
        • ►  Jun 25 (30)
        • ►  Jun 24 (32)
        • ►  Jun 23 (42)
        • ►  Jun 22 (38)
        • ►  Jun 21 (20)
        • ►  Jun 20 (30)
        • ►  Jun 19 (37)
        • ►  Jun 18 (15)
        • ►  Jun 17 (12)
        • ►  Jun 16 (52)
        • ►  Jun 15 (59)
        • ►  Jun 14 (49)
        • ►  Jun 13 (38)
        • ►  Jun 12 (39)
        • ►  Jun 11 (44)
        • ►  Jun 10 (22)
        • ►  Jun 09 (34)
        • ►  Jun 08 (39)
        • ►  Jun 07 (28)
        • ►  Jun 06 (38)
        • ►  Jun 05 (19)
        • ►  Jun 04 (20)
        • ►  Jun 03 (27)
        • ►  Jun 02 (27)
        • ►  Jun 01 (31)
      • ►  May (648)
        • ►  May 31 (32)
        • ►  May 30 (48)
        • ►  May 29 (46)
        • ►  May 28 (43)
        • ►  May 27 (19)
        • ►  May 26 (37)
        • ►  May 25 (29)
        • ►  May 24 (22)
        • ►  May 23 (23)
        • ►  May 22 (18)
        • ►  May 21 (18)
        • ►  May 20 (22)
        • ►  May 19 (28)
        • ►  May 18 (12)
        • ►  May 17 (24)
        • ►  May 16 (9)
        • ►  May 15 (18)
        • ►  May 14 (13)
        • ►  May 13 (16)
        • ►  May 12 (6)
        • ►  May 11 (15)
        • ►  May 10 (15)
        • ►  May 09 (25)
        • ►  May 08 (14)
        • ►  May 07 (15)
        • ►  May 06 (10)
        • ►  May 04 (21)
        • ►  May 03 (22)
        • ►  May 02 (9)
        • ►  May 01 (19)
      • ►  April (490)
        • ►  Apr 30 (7)
        • ►  Apr 29 (21)
        • ►  Apr 28 (19)
        • ►  Apr 27 (15)
        • ►  Apr 26 (12)
        • ►  Apr 25 (19)
        • ►  Apr 24 (13)
        • ►  Apr 23 (24)
        • ►  Apr 22 (24)
        • ►  Apr 21 (22)
        • ►  Apr 20 (19)
        • ►  Apr 19 (46)
        • ►  Apr 18 (24)
        • ►  Apr 17 (15)
        • ►  Apr 16 (19)
        • ►  Apr 15 (8)
        • ►  Apr 14 (19)
        • ►  Apr 13 (22)
        • ►  Apr 12 (18)
        • ►  Apr 11 (11)
        • ►  Apr 10 (13)
        • ►  Apr 09 (12)
        • ►  Apr 08 (12)
        • ►  Apr 07 (15)
        • ►  Apr 06 (16)
        • ►  Apr 05 (10)
        • ►  Apr 04 (8)
        • ►  Apr 03 (15)
        • ►  Apr 01 (12)
      • ►  March (445)
        • ►  Mar 31 (7)
        • ►  Mar 30 (10)
        • ►  Mar 29 (17)
        • ►  Mar 28 (15)
        • ►  Mar 27 (8)
        • ►  Mar 26 (11)
        • ►  Mar 25 (10)
        • ►  Mar 24 (9)
        • ►  Mar 23 (13)
        • ►  Mar 22 (9)
        • ►  Mar 21 (13)
        • ►  Mar 20 (9)
        • ►  Mar 19 (15)
        • ►  Mar 18 (14)
        • ►  Mar 17 (11)
        • ►  Mar 16 (15)
        • ►  Mar 15 (23)
        • ►  Mar 14 (26)
        • ►  Mar 13 (20)
        • ►  Mar 12 (14)
        • ►  Mar 11 (18)
        • ►  Mar 10 (27)
        • ►  Mar 09 (18)
        • ►  Mar 08 (25)
        • ►  Mar 07 (11)
        • ►  Mar 06 (15)
        • ►  Mar 05 (18)
        • ►  Mar 04 (9)
        • ►  Mar 03 (14)
        • ►  Mar 02 (7)
        • ►  Mar 01 (14)
      • ►  February (258)
        • ►  Feb 29 (22)
        • ►  Feb 28 (14)
        • ►  Feb 27 (12)
        • ►  Feb 26 (4)
        • ►  Feb 25 (17)
        • ►  Feb 24 (16)
        • ►  Feb 23 (16)
        • ►  Feb 22 (8)
        • ►  Feb 21 (23)
        • ►  Feb 20 (6)
        • ►  Feb 19 (5)
        • ►  Feb 18 (3)
        • ►  Feb 17 (9)
        • ►  Feb 16 (17)
        • ►  Feb 15 (20)
        • ►  Feb 14 (10)
        • ►  Feb 13 (17)
        • ►  Feb 11 (3)
        • ►  Feb 10 (1)
        • ►  Feb 08 (2)
        • ►  Feb 07 (5)
        • ►  Feb 05 (2)
        • ►  Feb 04 (10)
        • ►  Feb 03 (7)
        • ►  Feb 02 (1)
        • ►  Feb 01 (8)
      • ►  January (8)
        • ►  Jan 30 (4)
        • ►  Jan 10 (4)
    • ►  2013 (23)
      • ►  February (18)
        • ►  Feb 07 (1)
        • ►  Feb 06 (2)
        • ►  Feb 05 (8)
        • ►  Feb 04 (5)
        • ►  Feb 02 (1)
        • ►  Feb 01 (1)
      • ►  January (5)
        • ►  Jan 31 (4)
        • ►  Jan 30 (1)

    Report Abuse

    Follower

    Translate

    Total Pageviews

    nuffnang ads

    Nuffnang Ads

    nuffnang ads

    Nuffnang Ads

    Picture Window theme. Theme images by sndrk. Powered by Blogger.