Everything About Wood

Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.

Blog List

Thursday, 7 July 2016

Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo

Published Date
February 2015, Vol.3(1):74–79, doi:10.1016/j.cj.2014.10.001
Open Access, Creative Commons license, Funding information

Title 

Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo

  • Author 
  • Chaoxian Liu 1
  • Jiuguang Wang 1
  • Xiupeng Mei
  • Xiaojing Deng
  • Tingting Yu
  • Xiaoli Liu
  • Guoqiang Wang
  • Zhizhai Liu
  • Yilin Cai ,
  • Maize Research Institute, Southwest University, Chongqing 400715, China
Received 28 January 2014. Revised 10 October 2014. Accepted 3 December 2014. Available online 15 December 2014.

Abstract
ZAG2 has been identified as a maternally expressed imprinted gene in maize endosperm. Our study revealed that paternally inherited ZAG2 alleles were imprinted in maize endosperm and embryo at 14 days after pollination (DAP), and consistently imprinted in endosperm at 10, 12, 16, 18, 20, 22, 24, 26, and 28 DAP in reciprocal crosses between B73 and Mo17. ZAG2 alleles were also imprinted in reciprocal crosses between Zheng 58 and Chang 7-2 and between Huang C and 178. ZAG2alleles exhibited differential imprinting in hybrids of 178 × Huang C and B73 × Mo17, while in other hybrids ZAG2 alleles exhibited binary imprinting. The tissue-specific expression pattern of ZAG2 showed that ZAG2 was expressed at a high level in immature ears, suggesting that ZAG2 plays important roles in not only kernel but ear development.

Keywords
  • Gene imprinting
  • ZAG2
  • Expression pattern
  • Endosperm
  • Embryo

  • 1 Introduction

    Genomic imprinting, the differential expression of alleles depending on parental origin, is an epigenetic phenomenon occurring in mammals as well as in angiosperms [1]. In mammals, imprinting usually occurs in embryonic and extra-embryonic tissues [2]. In flowering plants, the majority of imprinted genes are expressed in triploid endosperm [3], [4] and [5]. R1, which regulates anthocyanin biosynthesis in maize endosperm, was the first-discovered gene showing genomic imprinting. When R1 was inherited maternally, the full kernel was pigmented, whereas when R1 was inherited paternally, the kernel exhibited mottled pigmentation [6]. Later, genomic imprinting was also discovered in mouse. A nuclear transplantation experiment showed that completion of mouse embryogenesis required both the maternal and paternal genomes, and that two copies of either the paternal or the maternal genome were not sufficient for normal development of mouse embryos [7]and [8]. Although imprinting was first discovered in plants, studies have been widely conducted in mammals. It is well established that imprinted genes regulate placenta development and fetal growth in mammals and that a change of methylation status of imprinted genes may cause human disease [9].
    Imprinted loci are classified as paternally or maternally imprinted, depending upon which parental allele is expressed. In maize, paternally imprinted genes include Meg1[10], nrp1 [11], dzr1 [12], Mez1 [13] and [14], fie1, and fie2 [15], etc. By contrast, maternally imprinted genes are fewer [16]. With the development of modern sequencing technology, 111 maternally imprinted and 68 paternally imprinted genes were newly identified in 10 DAP endosperm from reciprocal crosses between inbred lines B73 and Mo17, according to whether the expression of a given allele was fivefold greater than that of the other allele [17]. A similar study was performed by Waters et al. [18], but employing different criteria: a gene designated as imprinted required 90% of reads to be from one allele. As a result, 100 putative imprinted genes were identified in endosperm 14 days after pollination (DAP) from reciprocal crosses between B73 and Mo17, including 54 maternally and 46 paternally expressed imprinted genes. Though only 50 genes were common to the 100 and 179 genes designated as imprinted by these two research groups, these studies still greatly expanded the number of imprinted genes in maize. ZAG2 is one of the 50 imprinted genes identified in common. ZAG2, as well as the imprinted gene OsMADS87 in rice [19] and PHE1 in Arabidopsis [20], is also a MADS-box transcription factor. Here we report the imprinting characterization of ZAG2 in three reciprocal crosses and evaluate the tissue-specific expression pattern of ZAG2, with the aim of elucidating the function of ZAG2 in maize development.

    2 Materials and methods

    2.1 Plant material and growth conditions

    Maize inbred lines including B73, Mo17, Zheng 58, Chang 7-2, Huang C, and 178 were planted in spring at Beibei (29°76′N, 106°37′E), Chongqing, China. Among these inbred lines, B73 and Mo17 were the most widely used elite inbred lines worldwide. Zheng 58 and Chang 7-2 and Huang C and 178 were the respective parents of Zhengdan 958 and Nongda 108, well-known corn hybrids in China. Endosperm tissues were collected at 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28 DAP. Embryos were harvested at 14 and 18 DAP. Tissues at the same developmental stage derived from different ears were pooled prior to RNA or DNA extraction. Additionally, the root, stem, leaf, immature tassel (3–4 cm), and ear (3–4 cm) were collected from B73.

    2.2 Total RNA extraction and cDNA synthesis

    Samples were ground in liquid nitrogen. Ground tissue (200 mg) was treated with 1 mL Trizol (Invitrogen). Total RNA was isolated and then digested with DNaseI to remove genomic DNA before use.
    Approximately 1 mg of total RNA was used as a template for cDNA synthesis, using an oligo(dT) primer according to the specifications of RevertAid First Strand cDNA Synthesis Kit (Fermentas). The quality of the synthesized cDNA was evaluated by actin amplification.

    2.3 Development of cleaved amplified polymorphic sequence (CAPS) markers

    Gene specific primers (GSP) were designed with Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index. cgi?LINK_LOC = BlastHome) and used to amplify the target sequence of ZAG2 cDNA for CAPS marker development. The main parameters were as follows: primer size of about 22 bp, primer GC content of 40–60%, and no more than 0.7 °C difference melting temperature between forward primer and reverse primer. The PCR products were cloned and sequenced for identifying single-nucleotide polymorphisms. SNPs that created restriction sites were selected for development of CAPS markers with SNP2CAPS [21]. To test the CAPS markers, PCR products were digested with an appropriate FastDigest enzyme (Fermentas) for 5 min with incubation at the corresponding temperature, and then resolved on 1% agarose stained with GoodView (SBS).

    2.4 Tissue-specific gene expression analysis of the ZAG2 gene

    Tissue-specific expression of ZAG2 was assessed by real-time quantitative RT-PCR, performed on a CFX96 Touch Cycler (Bio-Rad). The detection of amplification rates was performed using THUNDERBIRD qPCR Mix (TOYOBO). ZAG2 mRNA expression was normalized against actin. Every sample had three technical replicates. The cycle parameters were as follows: an initial denaturation step of 60 s at 95 °C, and then denaturation at 95 °C for 15 s and annealing and extension at 64 °C for 60 s, for 45 cycles of PCR.

    3 Results

    3.1 Characterization of ZAG2

    According to the putative cDNA sequence (GRMZM2G160687), the gene-specific primer GSP-1 (Table 1) flanking the open reading frame (ORF) was designed to amplify the target gene from cDNA of 14 DAP maize kernels. The PCR products were sequenced and BLASTed against the Reference RNA Sequences database and High Throughput Genomic Sequences database of Zea mays(http://www.ncbi.nlm.nih.gov/BLAST). The amplified sequence showed 99% identity with Zea mays AGAMOUS homolog2 (ZAG2). ZAG2 putatively encoded a protein composed of 269 amino acids and contained a typical MADS-box domain and K-box domain (Fig. 1), indicating that ZAG2 was a member of the MADS-box gene family.
    Table 1. Primers used for ZAG2 amplification, imprinting identification, and qPCR.
    PrimerForward sequence
    (5′–3′)
    Reverse sequence
    (5′–3′)
    Product size (bp)Restriction enzyme
    GSP-1TTATCTCTTCTGAGTGCTCCGCAGAACATCTAGAGGCAACAGCC1002
    GSP-2aTGAGAAAGGCATCTCTAAGATCAGGCACACACAAAAGGCAACAACAATA541Sph I
    Q-GSPTGAGAGGTACAAGAAGGCACACAAGAATGGGTTCAGCTCCAAGT417
    ActinTCACCCTGTGCTGCTGACCGGAACCGTGTGGCTCACACCA190
    • a
      Information from Zhang et al. (2011).
    Fig. 1. The conservative motifs of the ZAG2 protein.

    3.2 ZAG2 is a maternally expressed imprinted gene

    A CAPS marker, GSP-2 (Table 1) located at the 3′ terminus of the ZAG2 cDNA, was developed and used for amplifying the 14 DAP endosperm cDNAs of the reciprocal hybrids between B73 and Mo17. DNA sequencing showed that SNPs were present between B73 and Mo17 alleles and could be recognized by the enzyme Sph I. The digestion profile of the PCR products digested by Sph I indicated that the expression of ZAG2 from the maternal allele was greater than that from the paternal allele in B73 × Mo17 (Fig. 2). Thus, ZAG2 was a maternally expressed imprinted gene. Extremely weak expression of ZAG2 from the paternal allele was detected in B73 × Mo17, indicating that ZAG2 also displayed differential imprinting. However, the case was very different in Mo17 × B73, in which ZAG2 was thoroughly imprinted, indicating that ZAG2 displayed binary imprinting in this cross. Imprinting status was also evaluated in 14 DAP maize embryo (Fig. 3). The results showed that ZAG2 was imprinted in embryo as well as in endosperm.
    Fig. 2. The digestion profile of the PCR products amplified from 14 DAP endosperm of B73, Mo17 and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize endosperm. M: Mo17; B: B73.
    Fig. 3. The digestion profile of the PCR products amplified from 14 DAP embryo of B73, Mo17, and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize embryo.

    3.3 ZAG2 shows gene-specific imprinting

    To determine whether ZAG2 was also imprinted in other hybrids, GSP-2 was used for amplifying 14 DAP endosperm cDNA from Huang C, 178, Huang C × 178, 178 × Huang C, Zheng 58, Chang 7-2, Zheng 58 × Chang 7-2, and Chang 7-2 × Zheng 58. The sequenced PCR products showed that SNPs distinguishing Huang C and 178, Zheng 58, and Chang 7-2 could be recognized by Sph I. The digestion profile showed that all of the ZAG2 alleles were paternally imprinted in the reciprocal hybrids (Fig. 4). With the imprinting pattern in the reciprocal hybrid between B73 and Mo17, these findings indicate that ZAG2 showed gene-specific imprinting.
    Fig. 4. The digestion profile of PCR products, indicating that ZAG2 showed gene-specific imprinting. H: Huang C; C: Chang 7-2; Z: Zheng 58.

    3.4 Imprinting characterization of ZAG2 at different developmental stages in maize endosperm

    To characterize imprinting in maize endosperm, endosperm was collected every two days from 10 to 28 DAP. In the same way as mentioned above, the PCR products were digested with Sph I and then separated by 1% gel electrophoresis. The digestion profile showed that ZAG2 was consistently imprinted in B73 × Mo17 and Mo17 × B73 from 10 to 28 DAP in maize endosperm (Fig. 5). The expression of ZAG2showed differential imprinting at 22, 24, and 28 DAP in B73 × Mo17 (Fig. 5-a), and at 16, 22, 24, and 28 DAP in Mo17 × B73 (Fig. 5-b). At other stages, ZAG2 exhibited binary imprinting.
    Fig. 5. Imprinting characterization of ZAG2 in different developmental stages of endosperm in B73 × Mo17 and Mo17 × B73. *indicates that ZAG2 expression showed differential imprinting.

    3.5 Tissue-specific expression pattern of ZAG2

    A tissue-specific expression pattern directly reflects the location where a gene functions. Accordingly, cDNAs from root, stem, leaf, immature tassel (3–4 cm), immature ear (3–4 cm), 18 DAP endosperm, and 18 DAP embryo of inbred line B73 were synthesized. The primer Q-GSP (Table 1) was designed for amplifying ZAG2 in the different B73 tissues. The qRT-PCR results indicated that ZAG2 was expressed primarily in immature ear and 18 DAP embryo. Extremely weak signals were detected in stem, immature tassel and 18 DAP endosperm and no signal was detected in root or leaf (Fig. 6). These results suggest that ZAG2 plays important roles in maize immature ear and kernel development.
    Fig. 6. Tissue-specific expression pattern of ZAG2 in B73.

    4 Discussion

    Genomic imprinting has been shown to play important roles in seed development. Berger and Chaudhury pointed out that an additional dosage of the paternal genome increased endosperm size and that an additional maternal dosage reduced endosperm size [22]. RNA-seq of 10 and 14 DAP endosperm of reciprocal hybrids between B73 and Mo17 greatly expanded the number of imprinted genes including ZAG2 in maize [17] and [18]. Although genomic imprinting in maize has attracted wide interest, the function of most imprinted plant genes is not well characterized [23]. As a first step toward addressing this issue, we studied the imprinting type and expression pattern of ZAG2 in three reciprocal hybrids.
    Imprinted gene expression is classified as gene-specific imprinting (in which all the alleles at a given locus are imprinted) or allele-specific imprinting (in which certain alleles at a specific locus are imprinted), differential imprinting (in which both alleles are expressed, but one allele is expressed dominantly), or binary imprinting (in which only one allele is expressed) [24]. Our results showed that ZAG2 exhibited differential imprinting in hybrids of B73 × Mo17 and 178 × Huang C, but binary imprinting in other hybrids. The difference could be caused by different genetic backgrounds. It can be concluded that ZAG2 is a maternally expressed locus-specific imprinted gene, given that all the ZAG2 alleles were imprinted when paternally inherited. In maize, the majority of imprinted genes are subject to a parent-of-origin pattern of expression at a given locus, and gene-specific imprinting usually occurs during early stages of endosperm development [10]. ZAG2 was consistently imprinted in endosperm from 10 to 28 DAP, a pattern similar to that of fie1 in maize [15] and FIS2in Arabidopsis [25]. Interestingly, ZAG2 was also imprinted in embryo at 14 DAP. It appears that ZAG2 played an important role in embryo development, but the expression pattern also indicated that ZAG2 played an important role in immature ear development. A previous study showed that imprinted genes crucially affect seed development in flowering plants [26]. To date, the function of only one imprinted maize gene has been completely established [27]. The imprinting and expression pattern of ZAG2 will shed light on the function of ZAG2 in kernel development.

    Acknowledgment

    This study was supported by the Fundamental Research Funds for the Central Universities (XDJK2013C023), the Chongqing Postdoctoral Science Foundation(Xm201344), the China Postdoctoral Science Foundation (2014M552303), the Research Fund for the Doctoral Program of Southwest University (SWU112037) and the Research Fund for the Doctoral Program of Higher Education (2011182120011).

    References

      • [1]
      • M. Gehring, Y. Choi, R.L. Fischer
      • Imprinting and seed development
      • Plant Cell, Volume 16, 2004, pp. S203–S213
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (120)
      • [2]
      • W. Reik, J. Walter
      • Genomic imprinting: parental influence on the genome
      • Nat. Rev. Genet., Volume 2, 2001, pp. 21–32
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1404)
      • [3]
      • M. Luo, J.M. Taylor, A. Spriggs, H. Zhang, X. Wu, S. Russell, M. Singh, A. Koltunow
      • A genome-wide survey of imprinted genes in rice seeds reveals imprinting primarily occurs in the endosperm
      • PLoS Genet., Volume 7, Issue 6, 2011, p. e1002125, doi:10.1371/journal.pgen.1002125
      • Full Text via CrossRef
      • [4]
      • T.-F. Hsieh, J. Shin, R. Uzawa, P. Silva, S. Cohen, M.J. Bauer, M. Hashimoto, R.C. Kirkbride, J.J. Harada, D. Zilberman
      • Regulation of imprinted gene expression in Arabidopsis endosperm
      • Proc. Natl. Acad. Sci. U. S. A., Volume 108, 2011, pp. 1755–1762
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (123)
      • [5]
      • J.H. Huh, M.J. Bauer, T.-F. Hsieh, R. Fischer
      • Endosperm gene imprinting and seed development
      • Curr. Opin. Genet. Dev., Volume 17, 2007, pp. 480–485
      • Article
         | 
         PDF (437 K)
         | 
        View Record in Scopus
        Citing articles (36)
      • [6]
      • J. Kermicle
      • Dependence of the R-mottled aleurone phenotype in maize on mode of sexual transmission
      • Genetics, Volume 66, 1970, pp. 69–85
      • View Record in Scopus
        Citing articles (123)
      • [7]
      • J. McGrath, D. Solter
      • Completion of mouse embryogenesis requires both the maternal and paternal genomes
      • Cell, Volume 37, 1984, pp. 179–183
      • Article
         | 
         PDF (584 K)
         | 
        View Record in Scopus
        Citing articles (812)
      • [8]
      • M. Surani, S. Barton, M. Norris
      • Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis
      • Nature, Volume 308, 1984, pp. 548–550
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (750)
      • [9]
      • G. Egger, G. Liang, A. Aparicio, P.A. Jones
      • Epigenetics in human disease and prospects for epigenetic therapy
      • Nature, Volume 429, 2004, pp. 457–463
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1515)
      • [10]
      • J.F. Gutiérrez-Marcos, L.M. Costa, C. Biderre-Petit, B. Khbaya, D.M. O'Sullivan, M. Wormald, P. Perez, H.G. Dickinson
      • Maternally expressed gene1 is a novel maize endosperm transfer cell-specific gene with a maternal parent-of-origin pattern of expression
      • Plant Cell, Volume 16, 2004, pp. 1288–1301
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (118)
      • [11]
      • M. Guo, M.A. Rupe, O.N. Danilevskaya, X. Yang, Z. Hu
      • Genome-wide mRNA profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm
      • Plant J., Volume 36, 2003, pp. 30–44
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (110)
      • [12]
      • S. Chaudhuri, J. Messing
      • Allele-specific parental imprinting of dzr1, a posttranscriptional regulator of zein accumulation
      • Proc. Natl. Acad. Sci. U. S. A., Volume 91, 1994, pp. 4867–4871
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (65)
      • [13]
      • W.J. Haun, S. Laoueillé-Duprat, M.J. O'Connell, C. Spillane, U. Grossniklaus, A.R. Phillips, S.M. Kaeppler, N.M. Springer
      • Genomic imprinting, methylation and molecular evolution of maize enhancer of zeste (Mez) homologs
      • Plant J., Volume 49, 2007, pp. 325–337
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (70)
      • [14]
      • S. Jahnke, S. Scholten
      • Epigenetic resetting of a gene imprinted in plant embryos
      • Curr. Biol., Volume 19, 2009, pp. 1677–1681
      • Article
         | 
         PDF (569 K)
         | 
        View Record in Scopus
        Citing articles (74)
      • [15]
      • O.N. Danilevskaya, P. Hermon, S. Hantke, M.G. Muszynski, K. Kollipara, E.V. Ananiev
      • Duplicated fie genes in maize expression pattern and imprinting suggest distinct functions
      • Plant Cell, Volume 15, 2003, pp. 425–438
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (118)
      • [16]
      • J.F. Gutierrez-Marcos, P.D. Pennington, L.M. Costa, H.G. Dickinson
      • Imprinting in the endosperm: a possible role in preventing wide hybridization
      • Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci., Volume 358, 2003, pp. 1105–1111
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (61)
      • [17]
      • M. Zhang, H. Zhao, S. Xie, J. Chen, Y. Xu, K. Wang, H. Zhao, H. Guan, X. Hu, Y. Jiao
      • Extensive, clustered parental imprinting of protein-coding and noncoding RNAs in developing maize endosperm
      • Proc. Natl. Acad. Sci. U. S. A., Volume 108, 2011, pp. 20042–20047
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (62)
      • [18]
      • A.J. Waters, I. Makarevitch, S.R. Eichten, R.A. Swanson-Wagner, C.-T. Yeh, W. Xu, P.S. Schnable, M.W. Vaughn, M. Gehring, N.M. Springer
      • Parent-of-origin effects on gene expression and DNA methylation in the maize endosperm
      • Plant Cell, Volume 23, 2011, pp. 4221–4233
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (74)
      • [19]
      • R. Ishikawa, T. Ohnishi, Y. Kinoshita, M. Eiguchi, N. Kurata, T. Kinoshita
      • Rice interspecies hybrids show precocious or delayed developmental transitions in the endosperm without change to the rate of syncytial nuclear division
      • Plant J., Volume 65, 2011, pp. 798–806
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (33)
      • [20]
      • C. Köhler, D.R. Page, V. Gagliardini, U. Grossniklaus
      • The Arabidopsis thaliana MEDEA Polycomb group protein controls expression of PHERES1 by parental imprinting
      • Nat. Genet., Volume 37, 2004, pp. 28–30
      • View Record in Scopus
        Citing articles (2)
      • [21]
      • T. Thiel, R. Kota, I. Grosse, N. Stein, A. Graner
      • SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development
      • Nucleic Acids Res., Volume 32, 2004, p. e5
      • View Record in Scopus
        Citing articles (63)
      • [22]
      • F. Berger, A. Chaudhury
      • Parental memories shape seeds
      • Trends Plant Sci., Volume 14, 2009, pp. 550–556
      • Article
         | 
         PDF (361 K)
         | 
        View Record in Scopus
        Citing articles (54)
      • [23]
      • A.J. Waters, P. Bilinski, S.R. Eichten, M.W. Vaughn, J. Ross-Ibarra, M. Gehring, N.M. Springer
      • Comprehensive analysis of imprinted genes in maize reveals allelic variation for imprinting and limited conservation with other species
      • Proc. Natl. Acad. Sci. U. S. A., Volume 110, 2013, pp. 19639–19644
      • View Record in Scopus
        Citing articles (19)
      • [24]
      • P. Bhavani, K. Harinikumar, H. Shashidhar, S.M. Zargar
      • Genetic imprinting in maize
      • Maize Genomics Genet., Volume 3, 2012, pp. 13–21
      • [25]
      • M. Luo, P. Bilodeau, E.S. Dennis, W.J. Peacock, A. Chaudhury
      • Expression and parent-of-origin effects for FIS2, MEA, and FIE in the endosperm and embryo of developing Arabidopsis seeds
      • Proc. Natl. Acad. Sci. U. S. A., Volume 97, 2000, pp. 10637–10642
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (280)
      • [26]
      • M.T. Raissig, C. Baroux, U. Grossniklaus
      • Regulation and flexibility of genomic imprinting during seed development
      • Plant Cell, Volume 23, 2011, pp. 16–26
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (71)
      • [27]
      • L.M. Costa, J. Yuan, J. Rouster, W. Paul, H. Dickinson, J.F. Gutierrez-Marcos
      • Maternal control of nutrient allocation in plant seeds by genomic imprinting
      • Curr. Biol., Volume 22, 2012, pp. 160–165
      • Article
         | 
         PDF (1014 K)
         | 
        View Record in Scopus
        Citing articles (56)
    • ⁎ 
      Corresponding author.
    • 1
      Chaoxian Liu and Jiuguang Wang contributed equally to this work.

    For further details log on website :
    http://www.sciencedirect.com/science/article/pii/S2214514114000920
    at July 07, 2016
    Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest

    No comments:

    Post a Comment

    Newer Post Older Post Home
    Subscribe to: Post Comments (Atom)

    Advantages and Disadvantages of Fasting for Runners

    Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...

    • Pengalaman bekerja sebagai kerani kilang.
      Assalamualaikum dan salam sejahtera chu olls.     Alhamdulillah sudah seminggu saya melalui pengalaman bermakna ini. Sebagai seorang pel...
    • MIDA- INDUSTRI BERASASKAN KAYU
      Industri berasaskan kayu di Malaysia terdiri daripada  Kayu bergergaji; Venir dan produk panel yang termasuk papan lapis dan produk ...
    • Advantages and Disadvantages of Fasting for Runners
      Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...
    • UKIRAN KAYU DALAM MASYARAKAT MELAYU
      Seni ukiran kayu di kalangan masyarakat Melayu bukan sahaja terdapat pada rumah-rumah tetapi penjelmaan dan penerapannya terdapat pada is...
    • Laboratory Assessment of Forest Soil Respiration Affected by Wildfires under Various Environments of Russia
      International Journal of Ecology Volume 2017 (2017), Article ID 3985631, 10 pages https://doi.org/10.1155/2017/3985631 Author Evgeny  ...
    • Diploma Teknologi Berasaskan Kayu
      LATARBELAKANG POLITEKNIK KOTA KINABALU Politeknik Kota Kinabalu merupakan politeknik yang ketujuh ditubuhkan oleh Kementerian Pendidikan...
    • DIPLOMA REKA BENTUK PERABUT
      Sijil Teknologi Diploma Rekabentuk Perabot Kod Kursus :  K18 ...
    • Motif, Corak dan Ragi Tenun Melayu Riau
      Author MELAYU Riau kaya dengan khazanah budayanya. Antaranya yang amat menonjol adalah motif ornamen Melayunya, yang banyak dipakai untuk ...
    • SISTEM PENGURUSAN HUTAN
      Polisi dan Strategi Untuk memastikan HSK diurus secara berkekalan, "Dasar dan Strategi Pengurusan Hutan untuk Semenanjung ...
    • 5 Jenama Foundation Terbaik, Beli Di Farmasi Je!
      Beberapa minggu sudah, penulis pernah mencadangkan beberapa jenama maskara terbaik yang mudah didapati pada harga berpatutan dari farmas...

    nuffnang ads

    Search This Blog

    Pages

    • Home

    About Me

    Unknown
    View my complete profile

    Blog Archive

    • ►  2018 (371)
      • ►  June (17)
        • ►  Jun 22 (8)
        • ►  Jun 12 (1)
        • ►  Jun 11 (2)
        • ►  Jun 05 (6)
      • ►  May (6)
        • ►  May 31 (6)
      • ►  April (75)
        • ►  Apr 30 (1)
        • ►  Apr 27 (1)
        • ►  Apr 26 (15)
        • ►  Apr 25 (10)
        • ►  Apr 24 (11)
        • ►  Apr 18 (2)
        • ►  Apr 12 (4)
        • ►  Apr 10 (5)
        • ►  Apr 09 (9)
        • ►  Apr 05 (17)
      • ►  March (65)
        • ►  Mar 27 (7)
        • ►  Mar 22 (2)
        • ►  Mar 20 (4)
        • ►  Mar 13 (14)
        • ►  Mar 12 (11)
        • ►  Mar 08 (7)
        • ►  Mar 06 (1)
        • ►  Mar 05 (1)
        • ►  Mar 01 (18)
      • ►  February (103)
        • ►  Feb 28 (25)
        • ►  Feb 27 (27)
        • ►  Feb 26 (10)
        • ►  Feb 20 (1)
        • ►  Feb 19 (9)
        • ►  Feb 09 (13)
        • ►  Feb 06 (6)
        • ►  Feb 05 (5)
        • ►  Feb 02 (7)
      • ►  January (105)
        • ►  Jan 25 (11)
        • ►  Jan 23 (5)
        • ►  Jan 16 (6)
        • ►  Jan 15 (9)
        • ►  Jan 14 (7)
        • ►  Jan 10 (1)
        • ►  Jan 09 (2)
        • ►  Jan 08 (4)
        • ►  Jan 04 (24)
        • ►  Jan 03 (2)
        • ►  Jan 02 (21)
        • ►  Jan 01 (13)
    • ►  2017 (6160)
      • ►  December (11)
        • ►  Dec 30 (11)
      • ►  November (31)
        • ►  Nov 26 (9)
        • ►  Nov 07 (8)
        • ►  Nov 06 (3)
        • ►  Nov 01 (11)
      • ►  October (345)
        • ►  Oct 31 (4)
        • ►  Oct 25 (42)
        • ►  Oct 24 (5)
        • ►  Oct 23 (15)
        • ►  Oct 22 (3)
        • ►  Oct 18 (7)
        • ►  Oct 17 (27)
        • ►  Oct 16 (14)
        • ►  Oct 15 (6)
        • ►  Oct 13 (18)
        • ►  Oct 12 (44)
        • ►  Oct 11 (57)
        • ►  Oct 09 (47)
        • ►  Oct 06 (14)
        • ►  Oct 05 (1)
        • ►  Oct 04 (13)
        • ►  Oct 03 (17)
        • ►  Oct 02 (11)
      • ►  September (186)
        • ►  Sept 29 (3)
        • ►  Sept 26 (7)
        • ►  Sept 25 (18)
        • ►  Sept 21 (29)
        • ►  Sept 20 (10)
        • ►  Sept 19 (11)
        • ►  Sept 18 (2)
        • ►  Sept 14 (19)
        • ►  Sept 13 (28)
        • ►  Sept 11 (3)
        • ►  Sept 10 (15)
        • ►  Sept 08 (5)
        • ►  Sept 06 (22)
        • ►  Sept 05 (14)
      • ►  August (158)
        • ►  Aug 29 (10)
        • ►  Aug 28 (73)
        • ►  Aug 27 (2)
        • ►  Aug 21 (4)
        • ►  Aug 18 (17)
        • ►  Aug 17 (4)
        • ►  Aug 14 (13)
        • ►  Aug 11 (5)
        • ►  Aug 10 (4)
        • ►  Aug 09 (7)
        • ►  Aug 08 (1)
        • ►  Aug 06 (3)
        • ►  Aug 04 (2)
        • ►  Aug 03 (13)
      • ►  July (290)
        • ►  Jul 26 (9)
        • ►  Jul 25 (7)
        • ►  Jul 24 (25)
        • ►  Jul 23 (5)
        • ►  Jul 21 (13)
        • ►  Jul 18 (19)
        • ►  Jul 17 (18)
        • ►  Jul 14 (17)
        • ►  Jul 13 (75)
        • ►  Jul 12 (10)
        • ►  Jul 11 (64)
        • ►  Jul 10 (26)
        • ►  Jul 09 (2)
      • ►  June (522)
        • ►  Jun 30 (1)
        • ►  Jun 27 (3)
        • ►  Jun 22 (13)
        • ►  Jun 21 (41)
        • ►  Jun 20 (3)
        • ►  Jun 19 (68)
        • ►  Jun 16 (33)
        • ►  Jun 15 (87)
        • ►  Jun 13 (25)
        • ►  Jun 12 (26)
        • ►  Jun 09 (20)
        • ►  Jun 08 (60)
        • ►  Jun 07 (54)
        • ►  Jun 06 (53)
        • ►  Jun 05 (35)
      • ►  May (684)
        • ►  May 31 (6)
        • ►  May 22 (3)
        • ►  May 21 (14)
        • ►  May 20 (12)
        • ►  May 19 (3)
        • ►  May 18 (26)
        • ►  May 17 (63)
        • ►  May 16 (27)
        • ►  May 15 (25)
        • ►  May 14 (16)
        • ►  May 07 (9)
        • ►  May 06 (26)
        • ►  May 05 (74)
        • ►  May 04 (126)
        • ►  May 03 (51)
        • ►  May 02 (153)
        • ►  May 01 (50)
      • ►  April (759)
        • ►  Apr 29 (56)
        • ►  Apr 28 (37)
        • ►  Apr 27 (67)
        • ►  Apr 26 (87)
        • ►  Apr 25 (6)
        • ►  Apr 10 (4)
        • ►  Apr 09 (5)
        • ►  Apr 08 (78)
        • ►  Apr 07 (57)
        • ►  Apr 06 (52)
        • ►  Apr 05 (53)
        • ►  Apr 04 (43)
        • ►  Apr 03 (94)
        • ►  Apr 02 (28)
        • ►  Apr 01 (92)
      • ►  March (1744)
        • ►  Mar 31 (90)
        • ►  Mar 30 (74)
        • ►  Mar 29 (58)
        • ►  Mar 28 (50)
        • ►  Mar 27 (95)
        • ►  Mar 26 (58)
        • ►  Mar 25 (98)
        • ►  Mar 24 (94)
        • ►  Mar 23 (77)
        • ►  Mar 22 (43)
        • ►  Mar 21 (54)
        • ►  Mar 20 (43)
        • ►  Mar 19 (88)
        • ►  Mar 18 (65)
        • ►  Mar 17 (63)
        • ►  Mar 16 (94)
        • ►  Mar 15 (79)
        • ►  Mar 14 (35)
        • ►  Mar 11 (10)
        • ►  Mar 10 (43)
        • ►  Mar 09 (40)
        • ►  Mar 08 (27)
        • ►  Mar 07 (40)
        • ►  Mar 06 (62)
        • ►  Mar 05 (48)
        • ►  Mar 04 (63)
        • ►  Mar 03 (54)
        • ►  Mar 02 (13)
        • ►  Mar 01 (86)
      • ►  February (715)
        • ►  Feb 28 (10)
        • ►  Feb 27 (61)
        • ►  Feb 26 (31)
        • ►  Feb 24 (22)
        • ►  Feb 23 (31)
        • ►  Feb 22 (42)
        • ►  Feb 21 (30)
        • ►  Feb 20 (42)
        • ►  Feb 19 (43)
        • ►  Feb 18 (46)
        • ►  Feb 17 (39)
        • ►  Feb 16 (39)
        • ►  Feb 15 (24)
        • ►  Feb 14 (54)
        • ►  Feb 13 (25)
        • ►  Feb 12 (78)
        • ►  Feb 10 (53)
        • ►  Feb 09 (22)
        • ►  Feb 01 (23)
      • ►  January (715)
        • ►  Jan 30 (25)
        • ►  Jan 28 (19)
        • ►  Jan 27 (36)
        • ►  Jan 26 (27)
        • ►  Jan 24 (27)
        • ►  Jan 22 (22)
        • ►  Jan 21 (58)
        • ►  Jan 20 (20)
        • ►  Jan 19 (30)
        • ►  Jan 18 (39)
        • ►  Jan 17 (26)
        • ►  Jan 16 (36)
        • ►  Jan 15 (62)
        • ►  Jan 14 (22)
        • ►  Jan 13 (20)
        • ►  Jan 12 (33)
        • ►  Jan 11 (32)
        • ►  Jan 10 (26)
        • ►  Jan 05 (11)
        • ►  Jan 04 (22)
        • ►  Jan 03 (35)
        • ►  Jan 02 (34)
        • ►  Jan 01 (53)
    • ▼  2016 (6885)
      • ►  December (986)
        • ►  Dec 31 (12)
        • ►  Dec 30 (23)
        • ►  Dec 29 (15)
        • ►  Dec 28 (29)
        • ►  Dec 27 (32)
        • ►  Dec 26 (29)
        • ►  Dec 25 (39)
        • ►  Dec 24 (43)
        • ►  Dec 23 (29)
        • ►  Dec 22 (28)
        • ►  Dec 21 (46)
        • ►  Dec 20 (28)
        • ►  Dec 19 (36)
        • ►  Dec 18 (14)
        • ►  Dec 17 (24)
        • ►  Dec 16 (10)
        • ►  Dec 15 (43)
        • ►  Dec 14 (55)
        • ►  Dec 13 (38)
        • ►  Dec 12 (45)
        • ►  Dec 11 (26)
        • ►  Dec 10 (48)
        • ►  Dec 09 (34)
        • ►  Dec 08 (22)
        • ►  Dec 07 (29)
        • ►  Dec 06 (15)
        • ►  Dec 05 (45)
        • ►  Dec 04 (38)
        • ►  Dec 03 (41)
        • ►  Dec 02 (41)
        • ►  Dec 01 (29)
      • ►  November (600)
        • ►  Nov 30 (38)
        • ►  Nov 29 (36)
        • ►  Nov 28 (43)
        • ►  Nov 27 (22)
        • ►  Nov 26 (27)
        • ►  Nov 25 (39)
        • ►  Nov 24 (27)
        • ►  Nov 23 (37)
        • ►  Nov 22 (21)
        • ►  Nov 21 (32)
        • ►  Nov 20 (20)
        • ►  Nov 19 (31)
        • ►  Nov 18 (34)
        • ►  Nov 17 (29)
        • ►  Nov 16 (21)
        • ►  Nov 15 (33)
        • ►  Nov 14 (16)
        • ►  Nov 13 (3)
        • ►  Nov 12 (3)
        • ►  Nov 11 (1)
        • ►  Nov 09 (2)
        • ►  Nov 07 (14)
        • ►  Nov 04 (16)
        • ►  Nov 03 (17)
        • ►  Nov 02 (23)
        • ►  Nov 01 (15)
      • ►  October (374)
        • ►  Oct 31 (15)
        • ►  Oct 30 (2)
        • ►  Oct 29 (4)
        • ►  Oct 28 (25)
        • ►  Oct 27 (19)
        • ►  Oct 26 (16)
        • ►  Oct 25 (11)
        • ►  Oct 24 (14)
        • ►  Oct 23 (12)
        • ►  Oct 21 (14)
        • ►  Oct 20 (19)
        • ►  Oct 19 (21)
        • ►  Oct 18 (17)
        • ►  Oct 17 (15)
        • ►  Oct 16 (20)
        • ►  Oct 15 (12)
        • ►  Oct 14 (11)
        • ►  Oct 13 (21)
        • ►  Oct 12 (13)
        • ►  Oct 11 (6)
        • ►  Oct 10 (12)
        • ►  Oct 09 (17)
        • ►  Oct 08 (10)
        • ►  Oct 07 (11)
        • ►  Oct 06 (19)
        • ►  Oct 05 (13)
        • ►  Oct 03 (5)
      • ►  September (406)
        • ►  Sept 29 (6)
        • ►  Sept 28 (2)
        • ►  Sept 27 (12)
        • ►  Sept 16 (20)
        • ►  Sept 15 (34)
        • ►  Sept 14 (39)
        • ►  Sept 13 (32)
        • ►  Sept 12 (36)
        • ►  Sept 11 (18)
        • ►  Sept 10 (16)
        • ►  Sept 07 (6)
        • ►  Sept 06 (26)
        • ►  Sept 05 (14)
        • ►  Sept 04 (44)
        • ►  Sept 03 (17)
        • ►  Sept 02 (38)
        • ►  Sept 01 (46)
      • ►  August (777)
        • ►  Aug 31 (13)
        • ►  Aug 29 (22)
        • ►  Aug 28 (13)
        • ►  Aug 27 (26)
        • ►  Aug 26 (18)
        • ►  Aug 25 (14)
        • ►  Aug 24 (13)
        • ►  Aug 23 (22)
        • ►  Aug 22 (23)
        • ►  Aug 21 (20)
        • ►  Aug 20 (23)
        • ►  Aug 19 (13)
        • ►  Aug 18 (31)
        • ►  Aug 17 (36)
        • ►  Aug 16 (17)
        • ►  Aug 15 (33)
        • ►  Aug 14 (24)
        • ►  Aug 13 (28)
        • ►  Aug 12 (28)
        • ►  Aug 11 (28)
        • ►  Aug 10 (59)
        • ►  Aug 09 (33)
        • ►  Aug 08 (39)
        • ►  Aug 07 (23)
        • ►  Aug 06 (36)
        • ►  Aug 05 (23)
        • ►  Aug 04 (25)
        • ►  Aug 03 (17)
        • ►  Aug 02 (26)
        • ►  Aug 01 (51)
      • ▼  July (890)
        • ►  Jul 31 (27)
        • ►  Jul 30 (31)
        • ►  Jul 29 (29)
        • ►  Jul 28 (40)
        • ►  Jul 27 (32)
        • ►  Jul 26 (16)
        • ►  Jul 25 (5)
        • ►  Jul 24 (45)
        • ►  Jul 23 (16)
        • ►  Jul 22 (42)
        • ►  Jul 21 (11)
        • ►  Jul 20 (41)
        • ►  Jul 19 (31)
        • ►  Jul 18 (35)
        • ►  Jul 17 (41)
        • ►  Jul 16 (21)
        • ►  Jul 15 (23)
        • ►  Jul 14 (38)
        • ►  Jul 13 (49)
        • ►  Jul 12 (42)
        • ►  Jul 11 (25)
        • ►  Jul 10 (48)
        • ►  Jul 09 (33)
        • ►  Jul 08 (38)
        • ▼  Jul 07 (19)
          • 5 Symptoms of Stress Overload
          • Five Symptoms of Chronic Stress
          • Ab Exercises Without Equipment for Women
          • How to Get Nice Abs for Women
          • The Normal Heart Rate During a Panic Attack
          • Heart Rate on Stairs
          • Heart Rate & Body Positions
          • Cholesterol in Corn
          • Fruits That Lower Cholesterol
          • Carrots & Cholesterol
          • Dates and Cholesterol
          • How to Gain Weight With Dates & Tahini As a Vegan
          • Side Effects of Turmeric Capsules
          • Is Turmeric Safe for Children?
          • How Should I Take Curcumin & Turmeric Supplements?
          • Characterization of the imprinting and expression ...
          • Soil salinity: A serious environmental issue and p...
          • The Calcineurin B-Like Ca2+ Sensors CBL1 and CBL9 ...
          • How Do Sugars Regulate Plant Growth and Developmen...
        • ►  Jul 06 (10)
        • ►  Jul 05 (14)
        • ►  Jul 04 (13)
        • ►  Jul 03 (20)
        • ►  Jul 02 (26)
        • ►  Jul 01 (29)
      • ►  June (1003)
        • ►  Jun 30 (29)
        • ►  Jun 29 (43)
        • ►  Jun 28 (27)
        • ►  Jun 27 (33)
        • ►  Jun 26 (49)
        • ►  Jun 25 (30)
        • ►  Jun 24 (32)
        • ►  Jun 23 (42)
        • ►  Jun 22 (38)
        • ►  Jun 21 (20)
        • ►  Jun 20 (30)
        • ►  Jun 19 (37)
        • ►  Jun 18 (15)
        • ►  Jun 17 (12)
        • ►  Jun 16 (52)
        • ►  Jun 15 (59)
        • ►  Jun 14 (49)
        • ►  Jun 13 (38)
        • ►  Jun 12 (39)
        • ►  Jun 11 (44)
        • ►  Jun 10 (22)
        • ►  Jun 09 (34)
        • ►  Jun 08 (39)
        • ►  Jun 07 (28)
        • ►  Jun 06 (38)
        • ►  Jun 05 (19)
        • ►  Jun 04 (20)
        • ►  Jun 03 (27)
        • ►  Jun 02 (27)
        • ►  Jun 01 (31)
      • ►  May (648)
        • ►  May 31 (32)
        • ►  May 30 (48)
        • ►  May 29 (46)
        • ►  May 28 (43)
        • ►  May 27 (19)
        • ►  May 26 (37)
        • ►  May 25 (29)
        • ►  May 24 (22)
        • ►  May 23 (23)
        • ►  May 22 (18)
        • ►  May 21 (18)
        • ►  May 20 (22)
        • ►  May 19 (28)
        • ►  May 18 (12)
        • ►  May 17 (24)
        • ►  May 16 (9)
        • ►  May 15 (18)
        • ►  May 14 (13)
        • ►  May 13 (16)
        • ►  May 12 (6)
        • ►  May 11 (15)
        • ►  May 10 (15)
        • ►  May 09 (25)
        • ►  May 08 (14)
        • ►  May 07 (15)
        • ►  May 06 (10)
        • ►  May 04 (21)
        • ►  May 03 (22)
        • ►  May 02 (9)
        • ►  May 01 (19)
      • ►  April (490)
        • ►  Apr 30 (7)
        • ►  Apr 29 (21)
        • ►  Apr 28 (19)
        • ►  Apr 27 (15)
        • ►  Apr 26 (12)
        • ►  Apr 25 (19)
        • ►  Apr 24 (13)
        • ►  Apr 23 (24)
        • ►  Apr 22 (24)
        • ►  Apr 21 (22)
        • ►  Apr 20 (19)
        • ►  Apr 19 (46)
        • ►  Apr 18 (24)
        • ►  Apr 17 (15)
        • ►  Apr 16 (19)
        • ►  Apr 15 (8)
        • ►  Apr 14 (19)
        • ►  Apr 13 (22)
        • ►  Apr 12 (18)
        • ►  Apr 11 (11)
        • ►  Apr 10 (13)
        • ►  Apr 09 (12)
        • ►  Apr 08 (12)
        • ►  Apr 07 (15)
        • ►  Apr 06 (16)
        • ►  Apr 05 (10)
        • ►  Apr 04 (8)
        • ►  Apr 03 (15)
        • ►  Apr 01 (12)
      • ►  March (445)
        • ►  Mar 31 (7)
        • ►  Mar 30 (10)
        • ►  Mar 29 (17)
        • ►  Mar 28 (15)
        • ►  Mar 27 (8)
        • ►  Mar 26 (11)
        • ►  Mar 25 (10)
        • ►  Mar 24 (9)
        • ►  Mar 23 (13)
        • ►  Mar 22 (9)
        • ►  Mar 21 (13)
        • ►  Mar 20 (9)
        • ►  Mar 19 (15)
        • ►  Mar 18 (14)
        • ►  Mar 17 (11)
        • ►  Mar 16 (15)
        • ►  Mar 15 (23)
        • ►  Mar 14 (26)
        • ►  Mar 13 (20)
        • ►  Mar 12 (14)
        • ►  Mar 11 (18)
        • ►  Mar 10 (27)
        • ►  Mar 09 (18)
        • ►  Mar 08 (25)
        • ►  Mar 07 (11)
        • ►  Mar 06 (15)
        • ►  Mar 05 (18)
        • ►  Mar 04 (9)
        • ►  Mar 03 (14)
        • ►  Mar 02 (7)
        • ►  Mar 01 (14)
      • ►  February (258)
        • ►  Feb 29 (22)
        • ►  Feb 28 (14)
        • ►  Feb 27 (12)
        • ►  Feb 26 (4)
        • ►  Feb 25 (17)
        • ►  Feb 24 (16)
        • ►  Feb 23 (16)
        • ►  Feb 22 (8)
        • ►  Feb 21 (23)
        • ►  Feb 20 (6)
        • ►  Feb 19 (5)
        • ►  Feb 18 (3)
        • ►  Feb 17 (9)
        • ►  Feb 16 (17)
        • ►  Feb 15 (20)
        • ►  Feb 14 (10)
        • ►  Feb 13 (17)
        • ►  Feb 11 (3)
        • ►  Feb 10 (1)
        • ►  Feb 08 (2)
        • ►  Feb 07 (5)
        • ►  Feb 05 (2)
        • ►  Feb 04 (10)
        • ►  Feb 03 (7)
        • ►  Feb 02 (1)
        • ►  Feb 01 (8)
      • ►  January (8)
        • ►  Jan 30 (4)
        • ►  Jan 10 (4)
    • ►  2013 (23)
      • ►  February (18)
        • ►  Feb 07 (1)
        • ►  Feb 06 (2)
        • ►  Feb 05 (8)
        • ►  Feb 04 (5)
        • ►  Feb 02 (1)
        • ►  Feb 01 (1)
      • ►  January (5)
        • ►  Jan 31 (4)
        • ►  Jan 30 (1)

    Report Abuse

    Follower

    Translate

    Total Pageviews

    nuffnang ads

    Nuffnang Ads

    nuffnang ads

    Nuffnang Ads

    Picture Window theme. Theme images by sndrk. Powered by Blogger.