Everything About Wood

Find the information such as human life, natural resource,agriculture,forestry, biotechnology, biodiversity, wood and non-wood materials.

Blog List

Sunday, 24 July 2016

Ethylene response factor BnERF2-like (ERF2.4) from Brassica napus L. enhances submergence tolerance and alleviates oxidative damage caused by submergence in Arabidopsis thaliana

Published Date
June 2016, Vol.4(3):199–211, doi:10.1016/j.cj.2016.01.004
Open Access, Creative Commons license, Funding information

Title 

Ethylene response factor BnERF2-like (ERF2.4) from Brassica napus L. enhances submergence tolerance and alleviates oxidative damage caused by submergence in Arabidopsis thaliana ☆

  • Author 
  • Yanyan Lv a
  • Sanxiong Fu a
  • Song Chen a
  • Wei Zhang a
  • Cunkou Qi a,b,,
  • aInstitute of Industrial Crops, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
  • bJiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing 210095, China
Received 13 October 2015. Revised 14 January 2016. Accepted 2 February 2016. Available online 11 February 2016.

Abstract
Ethylene response factor proteins play an important role in regulating a variety of stress responses in plants, but their exact functions in submergence stress are not well understood. In this study, we isolated BnERF2.4 from Brassica napus L. to study its function in submergence tolerance. The expression of the BnERF2.4 gene in B. napus and the expression of antioxidant enzyme genes in transgenic Arabidopsiswere analyzed by quantitative RT-PCR. The expression of BnERF2.4 was induced by submergence in B. napus and the overexpression of BnERF2.4 in Arabidopsisincreased the level of tolerance to submergence and oxidative stress. A histochemical method detected lower levels of H2O2, O2•− and malondialdehyde (MDA) in transgenic Arabidopsis. Compared to the wild type, transgenic lines also had higher soluble sugar content and higher activity of antioxidant enzymes, which helped to protect plants against the oxidative damage caused by submergence. It was concluded that BnERF2.4 increased the tolerance of plants to submergence stress and may be involved in regulating soluble sugar content and the antioxidant system in defense against submergence stress.

Keywords
  • Ethylene response factor
  • Submergence
  • Oxidative damage
  • Ectopic expression
  • Arabidopsis
  • Antioxidant enzyme

  • 1 Introduction

    Biotic and abiotic stresses greatly impair the quality and production of crops worldwide. Excessive water in soil, known as flooding, waterlogging, or submergence, impedes normal crop growth by affecting plant anatomy, morphology, and physiology [1] and [2]. Plants grown in waterlogged fields can suffer hypoxic stress caused by difficulties in oxygen diffusion, leading to a decline in photosynthesis and respiration, degradation of chlorophyll, lipid peroxidation, and malondialdehyde (MDA) accumulation [3]. Ethanol, lactic acid, and other substances generated by anaerobic respiration are harmful to plant growth. Like various stresses that cause oxidative stress due to the production of reactive oxygen species (ROS), a lack of oxygen during waterlogging can also disrupt the balance of ROS generation and scavenging, leading to accumulation of ROS [4] and [5]. Waterlogging affects the levels of endogenous hormones such as ethylene (ET), abscisic acid (ABA), and cytokinin (CTK), disrupting the normal growth and development of plants [6] and [7]. In hypoxic and anoxic environments caused by waterlogging, plants have developed morphological and physiological mechanisms to defend themselves against the stress, such as increasing their soluble sugar content, promoting the activity of fermentative enzymes, and implementing the antioxidant defense system [8]. Many plants, such as Melilotus siculus [9], Oryza sativa [10], and Dendranthema [11], have developed aerenchyma to survive in hypoxic and anoxic conditions.
    The ethylene response factor (ERF) family proteins play an important role in regulating a variety of stress responses in plants. The ERF proteins belong to the AP2/ERF superfamily, which is present in all plants as transcription factors. Based on the number and types of AP2/ERF domains, the AP2/ERF superfamily can be divided into AP2, RAV, and ERF families [12]. The ERF family composes of a major portion of AP2/ERF superfamily proteins. Among AP2/ERF proteins, 120 of 148 in soybean (Glycine max L.) [13], 122 of 147 in Arabidopsis, and 139 of 188 in rice (O. sativa L.) belong to the ERF family [14]. The ERF family is divided into two subfamilies, the CBF/DREB and ERF subfamilies. Members of the ERF family participate in the plant's biotic and abiotic stress defense pathway by regulating the expression of downstream genes by binding their promoters with a specific sequence (such as the GCC box) [15].
    ERF genes have been identified in some model organisms including rice [16] and [17], Arabidopsis [18], soybean [13], and wheat (Triticum aestivum) [19]. The expression of nine GmERF genes from soybean can be induced by salt, cold, bacterial invasion, drought, and plant hormones. The expression of GmERF3 in tobacco plants enhances resistance to salt, drought, and diseases [13] and [20]. In tomato, the expression of JERF1 can be induced by ABA. In transgenic tobacco, the ectopic expression of JERF1 and JERF3 improves tolerance to osmotic stress, cold, and other stresses. JERF1-regulated gene expression is also involved in the synthesis of proline and ABA [21], [22] and [23]. Overexpression of AtERF98 in Arabidopsisenhances tolerance to salt stress by regulating the synthesis of ascorbic acid in transgenic plants [24]. There have been several reports on the function of ERF in waterlogging stress. Overexpression of Sub1A in rice enhances submergence tolerance [25], [26] and [27]. The Arabidopsis proteins HRE1 and HRE2 also belong to the ERF family. Licausi et al. [28] found that the hre1 and hre2 double mutant was more sensitive to anoxia than the wild type. Overexpression of HRE1 in Arabidopsisimproves anoxia tolerance, with higher activity of pyruvate decarboxylase and alcohol dehydrogenase than in the wild type. However, members of the ERF family regulate gene expression in different ways. By binding to specific promoter sequences (such as the GCC box), AtERF1, AtERF2, and AtERF5 of Arabidopsis activate the expression of downstream genes, whereas AtERF3 and AtERF4 inhibit the expression of downstream genes or the activity of other transcription factors [29].
    There have been reports about the role of ERF genes in cold tolerance in B. napus, but only a few ERF genes in oilseed rape have been studied in association with waterlogging stress [30], [31] and [32]. In this report, we isolated and studied the BnERF2.4 gene from B. napus. We found that the expression of the BnERF2.4 gene was induced by submergence. Wild-type Arabidopsis was more sensitive to submergence than BnERF2.4-overexpressing Arabidopsis. Overexpression of BnERF2.4 significantly enhanced submergence tolerance and increased the activity of antioxidant enzymes in transgenic plants. Our study provides further support for the role of BnERF in regulating submergence resistance.

    2 Materials and methods

    2.1 Plant material and submergence treatments

    Seeds of B. napus were germinated at 25 °C. Only germinated seeds were selected and transplanted to pots (height, 8 cm; diameter, 12 cm) containing a 1:1 mix of soil and vermiculite. The plants were grown in a growth chamber at 25 °C (day)/22 °C (night) under a 16-h light/8-h dark photoperiod. For submergence treatments, seedlings at the three-leaf stage were placed into a plastic container (height, 21 cm; diameter, 22 cm) with water covering the top of the seedlings by 2 cm. Nine treatments were designed to study the BnERF2.4 expression pattern in submergence-resistant lines of B. napus: T1, 3 h submergence; T2, 6 h submergence; T3, 12 h submergence; T4, 24 h submergence; T5, 72 h submergence; T6, 72 h submergence + 3 h recovery; T7, 72 h submergence + 6 h recovery; T8, 72 h submergence + 12 h recovery; and T9, 72 h submergence + 24 h recovery. A control was designed for each of the treatments, in which seedlings were cultivated with a normal water supply. All treatments were applied in triplicate. After the treatments, the leaves were immediately frozen in liquid nitrogen for RNA extraction.
    Seeds of wild-type and transgenic Arabidopsis (T2 generation) were surface sterilized in 75% ethanol for 1 min followed by 5% NaClO for 5 min. After washing in sterilized water 4 to 6 times, the wild-type seeds were germinated on MS medium and the transgenic seeds were germinated on MS medium containing 50 mg L− 1 kanamycin for selection. Kanamycin-resistant transgenic Arabidopsis were transferred to MS medium to grow for 1 week. Both sets of plants were then transferred to pots containing soil and vermiculite (1:1) and grown at 23 °C (day)/19 °C (night) under a 12-h light/12-h dark photoperiod. After 3 weeks, the following treatments were applied before morphology was recorded: 6 d submergence; 6 d submergence + 1 d recovery; 6 d submergence + 3 d recovery; and 6 d submergence + 6 d recovery; and control. To test antioxidant enzyme activity, H2O2 and O2•− accumulation, contents of chlorophyll, soluble sugar and MDA, the following treatments were conducted: t1, 3 d submergence; t2, 3 d submergence + 1 d recovery; t3, 3 d submergence + 3 d recovery; and control. All treatments were applied in triplicate.

    2.2 Isolation of BnERF2.4 and quantitative reverse transcription polymerase chain reaction (RT-PCR)

    The open reading frame (ORF) of BnERF2.4 was amplified by polymerase chain reaction (PCR) from its cDNA, using primers P1 and P2 (Table 1). The PCR product was purified from an agarose gel using a gel purification kit (Tiangen, Biotech, China) according to the manufacturer's instructions and then inserted into the pMD18-T vector (Takara, Japan). Successful insertion of BnERF2.4 gene into the pMD18-T vector was confirmed by DNA sequencing.
    Table 1. Primers used in the amplification of full-length BnERF2.4 cDNA and for quantitative RT-PCR.
    Primer namePrimer sequence (5′–3′)
    P1ATGTACGGACAGAGCGAGG
    P2CACAACCTCGCATTTCACC
    P3TATGTTAGTCTACGGTCTCC
    P4GCTGCCTTCTGTTTCTCCA
    P5CTGGTGATGGTGTGTCTCACAC
    P6GTTGTCTCATGGATTCCAGGAG
    P7GAGTAACTCAGGCAAACCG
    P8GATTTCCTGCCTTGACTAAG
    Fe SOD5 (AT5G51100)TTGGTTCGGGTTGGACAT
    Fe SOD3(AT5G51100)CCATACGAGCGGATTTAC
    Cu-Zn SOD 5 (AT2G28190)CTTCTCATTCCTCCTTCC
    Cu-Zn SOD 3 (AT2G28190)CAACTGTCAACGCTTTCG
    AtCAT 5 (AT1G20630)TGGAGGAGCCAATCACAG
    AtCAT 3(AT1G20630)AGACCAAGCGACCAACAG
    POD 5 (AT1G05240)GATAACAACGCCGCCATT
    POD 3(AT1G05240)ATCATCGCCGCTACAAAA
    The expression of BnERF2.4 under submergence stress in the submergence-resistant line of B. napus and its ectopic expression in transgenic Arabidopsis were analyzed by quantitative RT-PCR using the PrimeScript RT reagent kit (Takara, Japan). Primers P3 and P4 were used to amplify BnERF2.4, primers P5 and P6 were used to amplify ACTIN in B. napus, primers P7 and P8 were used for SAND in Arabidopsis as internal controls (Table 1), and primers for antioxidant enzyme genes are also shown in Table 1.

    2.3 Transformation of Arabidopsis and selection of transgenic plants

    The BnERF2.4 ORF was amplified by PCR using Pfu polymerase and primers P1 and P2 containing restriction sites for Xba I and Sma I. It was then inserted into the plant binary vector pBI121 under the control of the CaMV 35S promoter, producing pBI121-BnERF2.4 (Fig. 1a). Recombinant Agrobacterium tumefaciens (EHA105) clones were selected in YEB medium containing 50 mg/L kanamycin and full-length BnERF2.4cDNA was introduced into Arabidopsis (Columbia) by Agrobacterium-mediated transformation [33].
    Fig. 1. The pBI121 vector used to express BnERF2.4 in Arabidopsis (a). Alignment of the deduced amino acid sequence of BnERF2.4 with sequences of other ERFs from Brassica napus and Arabidopsis. The underlined sequence is the AP2/ERF domain (b).
    To select for the transgenic Arabidopsis, T1 seeds were sterilized in 75% ethanol for 1 min and 5% NaClO for 5 min and then washed for 4 to 6 times with sterile water. The T1 seeds were germinated on MS medium supplemented with 50 mg L− 1 kanamycin. Leaves from kanamycin-resistant seedlings were collected and RT-PCR was performed to assess the ectopic expression of BnERF2.4 in different transgenic lines, with the wild type as control. ERF-3 and ERF-4 represent two independent BnERF2.4-overexpressing lines. The T2 seeds were harvested for subsequent experiments. GUS staining was performed as described by Jefferson et al. [34] to confirm the insertion of BnERF2.4.

    2.4 Assay of chlorophyll, soluble sugar, and MDA content

    Chlorophyll solution was extracted from 0.2 g of fresh leaf tissue in 5 mL 95% (v/v) ethanol. Absorbance at 645, 652, and 663 nm was measured using a Shimadzu 2450 UV–visible Spectrometer.
    Soluble sugar content was determined by the anthrone method. Dried leaf powder (0.1 g) was added to 10 ml distilled water and the mixture was placed in a water bath at 100 °C for 20 min and then filtered into a 100-ml volumetric flask. The final volume of the reaction mixture was 6 mL, containing 1 mL sugar extract and 5 mL anthrone. The mixture was then boiled for 10 min at 100 °C and the absorbance at 620 nm was measured after it was cooled. A calibration curve constructed with D-glucose was used to determine the soluble sugar content.
    MDA content was determined according to Heath and Packer [35]. Fresh leaves (0.2 g) were homogenized in 1.6 mL 10% trichloroacetic acid (TCA), followed by centrifugation at 12,000 × g for 10 min. The supernatant was mixed with an equal volume of 0.67% 2-thiobarbituric acid (TBA), and then boiled at 100 °C for 30 min. Absorbances at 532 nm and 600 nm were measured.

    2.5 Histochemical detection of H2O2 and O2•− and assay of antioxidant enzyme activity

    Leaf disks were placed in a small beaker. H2O2 and O2•− were detected in the leaves by infiltration of 3,3-diaminobenzidine (DAB) and nitrotetrazolium blue chloride (NBT), respectively, as reported by Romero-Puertas et al. [36]. To detect H2O2, the leaf disks were immersed in 1 mg mL− 1 DAB solution (pH 5.8), vacuum infiltrated for 10 min, and then incubated at room temperature for 24 h without light until the appearance of brown spots. To detect O2•−, the leaf disks were immersed in 0.1% NBT, vacuum-infiltrated for 10 min, and illuminated until the appearance of blue spots. After staining, the leaves were washed in 95% ethanol and images were captured with an OLYMPUS SZX12 stereomicroscope.
    Superoxide dismutase (SOD) activity was determined using the method reported by Giannopolitis and Ries [37]. It was determined by its ability to inhibit the formation of nitroblue formazan from NBT. SOD activity was expressed as units (U) mg− 1 FW, the amount required to inhibit the photoreduction of NBT by 50% was defined as one unit of SOD. Each 3 mL reaction mixture contained 50 mmol L− 1 phosphate buffer (pH 7.8), 13 mmol L− 1 methionine (MET), 75 μmol L− 1 nitroblue tetrazolium (NBT), 2 μmol L− 1 riboflavin, 0.1 mmol L− 1 ethylenediaminetetraacetic acid (EDTA), and the appropriate amount of enzyme solution. The absorbance of this mixture was measured at 560 nm after a reaction time of 15 min under illumination (light intensity of 100 μmol m− 2 s− 1).
    Catalase (CAT) activity was measured using Aebi's method [38]. Each 3-mL reaction mixture contained 50 mmol L− 1 phosphate buffer (pH 7.0), the appropriate amount of enzyme solution, and 10 mmol L− 1 H2O2. Catalase activity was determined by measuring the change of absorbance at 240 nm. Activity was expressed in μmol min− 1 g− 1 FW.
    Peroxidase (POD) activity was determined by measuring the change of absorbance at 470 nm according to Zheng and Van Huystee [39]. Activity was expressed in μmol min− 1 g− 1 FW.

    2.6 Statistical analysis

    Significant differences among treatments were determined with DPS 9.50 (Data Processing System) [40].

    3 Results

    3.1 Identification and expression of BnERF2.4 in B. napus

    An ORF fragment of 687 bp was obtained by PCR amplification from B. napus cDNA using the conserved AP2/ERF domain sequence. The ORF sequence was identified by BLAST search. It showed high similarity to BnERF2.3.
    BnERF2.4 encodes 229 amino acids. It contains a typical AP2/ERF domain, with the 14th and 19th amino acids of the domain being alanine and aspartic acid, respectively, indicating that it belongs to the ERF subfamily. Multiple sequence alignment of the deduced amino acid sequence of BnERF2.4 with other ERF proteins, including BnERF2.3 (FJ788941.1), BnERF50 (HQ613948.1), HRE2 (AT2G47520), and HRE1 (AT1G72360) from B. napus and Arabidopsis, shows the conserved AP2/ERF domain (Fig. 1b).
    To study the expression of BnERF2.4 in response to submergence stress, 3-week-old submergence-resistant lines of B. napus were submerged, and BnERF2.4 transcript levels in total RNA extracted from leaves were determined by quantitative RT-PCR (Fig. 2). BnERF2.4 expression began to increase after 3 h of submergence and peaked after 12 h of submergence. The expression level of BnERF2.4 was twice that of the control after 12 h of submergence. After 72 h of submergence, the plants were severely damaged, leading to the decrease of BnERF2.4 expression. However, BnERF2.4 expression increased again once the water was removed. The results indicated that the BnERF2.4-encoded transcription factor was significantly induced in the early stages of submergence.
    Fig. 2. Real-time quantitative RT-PCR analysis of ERF2.4 gene expression in submergence-resistant line of B. napus under submergence stress treatments. Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.

    3.2 Effects of BnERF2.4 on submergence tolerance in transgenic Arabidopsis

    Transgenic Arabidopsis plants ectopically overexpressing BnERF2.4 under the control of CaMV 35S promoter, as a GUS fusion, were generated to study the function of BnERF2.4. Transformants were screened by kanamycin selection and PCR amplification with specific primers. The expression of BnERF2.4 in several lines of transgenic Arabidopsis was verified by quantitative RT-PCR (Fig. 3a). T2 seedlings from two individual transgenic lines, ERF-3 and ERF-4, were used in subsequent experiments. Histochemical staining of GUS confirmed transformation of Arabidopsiswith the BnERF2.4 gene. BnERF2.4-GUS activity was detected in the entire seedling of the transgenic Arabidopsis, but not in wild-type seedlings (Fig. 3b).
    Fig. 3. Quantitative RT-PCR analysis of BnERF2.4 gene expression in wild-type and transgenic Arabidopsis (a). Identification of transgenic Arabidopsis by GUS staining (b).
    There were no differences in shoot growth (Fig. 4a) and root elongation (Fig. 4b) between the wild type and the two transgenic lines under normal water supply conditions. After 6 d of submergence, the leaves of most of the wild-type plants were wilting, and the root elongation was apparently inhibited in wild-type Arabidopsis but not in the transgenic lines. After 6 d of submergence and 6 d of recovery, wild-type Arabidopsis with withered leaves had died, but the transgenic Arabidopsis resumed growth.
    Fig. 4. Growth (a) and root length (b) of wild type and transgenic Arabidopsis under submergence treatment. Data represents the means (± SD) of three replicates. Data represent means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
    After 3 d of submergence treatment, levels of chlorophyll a and chlorophyll b in both wild-type and transgenic Arabidopsis declined (Table 2). The chlorophyll content began to increase after 3 d of submergence and 3 d of recovery. The chlorophyll contents were significantly higher in ERF-3 and ERF-4 than in the wild type. After 3 d of submergence and 1 d of recovery, the content of chlorophyll a was 0.74 mg g− 1FW in the wild type but 0.92 mg g− 1 FW and 0.84 mg g− 1 FW in the two transgenic lines, respectively. After 3 d of submergence and 3 d of recovery treatment, there was no significant difference in chlorophyll content between wild-type and transgenic plants. The soluble sugar contents of the wild-type and transgenic Arabidopsis lines were also determined. After 3 d of submergence treatment, the soluble sugar content increased significantly in the transgenic lines but not in the wild type. This increase could have been due to improved tolerance of BnERF2.4-overexpressing Arabidopsisto submergence stress. This trend continued throughout the recovery process (Fig. 5).
    Table 2. Chlorophyll contents in wild-type and transgenic Arabidopsis under submergence treatments.
    TreatmentsChlorophyll a (mg g− 1 FW)
    Chlorophyll b (mg g− 1 FW)
    Wild typeERF-3ERF-4Wild typeERF-3ERF-4
    Control1.05 ± 0.10ab1.05 ± 0.11a1.00 ± 0.12abc0.38 ± 0.03a0.39 ± 0.02a0.37 ± 0.04ab
    3 d submergence0.88 ± 0.05de0.99 ± 0.00abcd0.89 ± 0.02cde0.28 ± 0.02d0.32 ± 0.01bcd0.30 ± 0.01d
    3 d submergence + 1 d recovery0.74 ± 0.03f0.92 ± 0.08bcde0.84 ± 0.04ef0.29 ± 0.02d0.34 ± 0.04abc0.31 ± 0.02cd
    3 d submergence + 3 d recovery0.87 ± 0.07def0.94 ± 0.06abcde0.91 ± 0.07cde0.31 ± 0.02bcd0.36 ± 0.02abc0.32 ± 0.02bcd
    Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
    Fig. 5. Soluble sugar contents in wild-type and transgenic Arabidopsis under submergence treatments. Data represent the means (± SD) of three replicates. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.

    3.3 Effects of submergence on production of H2O2, O2•−, and MDA in transgenic Arabidopsis

    The presence of H2O2 and O2•− in the plants was assessed using DAB and NBT staining, respectively (Fig. 6a and b). Small amounts of H2O2 and O2•− were accumulated in both wild type and transgenic Arabidopsis leaves under normal conditions. However, after 3 d of submergence treatment, H2O2 and O2•− started to accumulate and the amounts of H2O2 and O2•− were higher in wild type plants. After 3 d of submergence and 1 d of recovery treatment, significant amounts of H2O2 and O2•− were produced in both wild-type and transgenic plants, indicating that both had suffered significant oxidative damage. After 3 d of submergence and 3 d of recovery treatment, levels of H2O2 and O2•− continued to rise in the wild-type leaves, but significantly decreased in transgenic lines, showing that the transgenic Arabidopsishad suffered less oxidative damage from submergence.
    Fig. 6. Histochemical localization of H2O2 and O2•− by DAB (a) and NBT (b) staining and MDA contents in wild-type and transgenic Arabidopsis under submergence treatments (c). Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
    After 3 d of submergence treatment, the MDA level in wild-type Arabidopsisincreased significantly initially, and then decreased during the recovery period. But the MDA level in the transgenic Arabidopsis remained almost unchanged during the whole period (Fig. 6c). This result showed that the wild-type was more susceptible than the transgenic Arabidopsis to oxidative damage caused by submergence stress.

    3.4 Effect of submergence treatments on antioxidant enzyme activity and related genes expression in transgenic Arabidopsis

    Under submergence stress, plants suffered from oxidative damage, evidenced by the increase of H2O2, O2•− and the MDA accumulation (Fig. 6). The results showed that the oxidative damage caused by submergence was much lower in transgenic than in wild-type Arabidopsis, and the activities of SOD, POD, and CAT in the transgenic Arabidopsis were higher than in the wild type under the treatments (Fig. 7). These results were consistent with the gene expression profile by RT-PCR (Fig. 8). Expressions of Fe-SOD, Cu/Zn-SOD, and POD in transgenic lines were higher than in the wild type, even under control conditions. After 6 h of submergence, the expression of these genes increased in both transgenic and wild-type lines. Transgenic lines also showed higher expression of all of the above antioxidant enzyme genes. Thus, the overexpression of BnERF2.4 could activate the expression of antioxidant enzyme genes and increase antioxidant enzyme activities in transgenic plants, protecting plants from submergence damage.
    Fig. 7. Antioxidant enzyme activities in wild-type and transgenic Arabidopsis under submergence treatments. Data represent means (± SD) of three replications. Different characters indicate significant difference between wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.
    Fig. 8. Real-time quantitative RT-PCR analysis of BnERF, Fe-SOD (AT5G51100), CAT(AT1G20630), Cu–Zn SOD (AT2G28190), and POD (AT1G05240) in wild-type and transgenic Arabidopsis after 6 h submergence treatment. Data represent the means (± SD) of three replications. Different characters indicate significant difference between the wild-type and transgenic Arabidopsis at 0.01 ≤ P < 0.05.

    4 Discussion

    ERF family is a large family of transcriptional regulators involved in plant growth, development, and defense against biotic and abiotic stresses [12]. ERF family is part of the AP2/ERF superfamily, which also contains the AP2 and RAV families, distinguished on the basis of number and location of AP2/ERF domains [14]. Several ERF genes have been characterized in Arabidopsis [29], rice [14] and [16], wheat [19], and soybean [13]. Several AP2/ERF-family genes in B. napus have been studied [31], [32], [41] and [42]. BnERF2.4 belongs to the ERF subfamily, having a single AP2/ERF domain with conserved Ala14 and Asp19.
    ERF proteins participate in the mechanism of resistance to several biotic and abiotic stresses. Their expression can be induced by stresses such as pathogen attack [43], [44] and [45], salt [13], cold, and hormone treatment [32]. Overexpression of GmERF057 and GmERF089 from soybean confers increased tolerance to salt, bacterial pathogen attack, and drought in transgenic tobacco plants [13]. JERF1 from tobacco improved the drought resistance of transgenic rice seedlings [22]. The expression of ERF can also be induced by waterlogging stress or hypoxia. The effects of stress on ERF expression vary among plant species, tissues, and ERFtypes. HRE1 and HRE2 in Arabidopsis play important roles in low-oxygen signaling in plants. Expressions of both HRE1 and HRE2 were induced after 2 h of hypoxia treatment. HRE1 was expressed mainly in the root and HRE2 in both the shoot and the root in Arabidopsis. HRE1-overexpressing Arabidopsis showed improved tolerance of anoxia [28]. OsBIERF1 but not OsBIERF3 and OsBIERF4 transcripts from O. sativa were detected in water-treated rice seedlings [16]. In the present study, several ERF genes (data not shown) were obtained using the conserved AP2/ERF domain sequence. It was found that the expression of BnERF2.4 was induced in the early stages of submergence. Plants submerged for a short period of time reduced respiration and photosynthesis due to shortage of oxygen [4], and they needed to recover when the submergence treatment was stopped. BnERF2.4 was needed to regulate the signaling pathways. It was involved in protecting the plant against submergence stress and aided in the recovery from damage. Thus, the expression of BnERF2.4 increased in the early stages of submergence.
    To identify the role of BnERF2.4 in submergence resistance, we investigated the morphological and physiological differences between the wild type and two transgenic Arabidopsis lines, ERF-3 and ERF-4, under different submergence conditions. No morphological differences were observed under normal conditions or 3 d of submergence (data not shown). After 6 d of submergence treatment, the leaves of the wild-type and transgenic Arabidopsis lines became yellow and withered, a result consistent with those of a previous study of waterlogging effects on crops [46]. Under waterlogging conditions, the translocation of nitrogen from older leaves to younger leaves causes chlorosis of older leaves [47]. The same phenomenon was also observed in this study. It was noteworthy that the transgenic lines grew much better than the wild type. After 6 d of submergence and 6 d of recovery treatment, the wild-type plants were almost dead, whereas the transgenic plants were still alive and growing normally, suggesting that they were able to use the BnERF2.4-regulated pathways to recover from the damage.
    In fact, the plants suffered more serious damage during the recovery period than in the submergence phase. The production of oxidative molecules is characteristic of hypoxia and especially of reoxygenation [48]. A similar study in B. napus confirmed that physiological functions were retarded during waterlogging, and its adverse effects remained after waterlogging had ceased [49]. Malik et al. [50] found no apparent effects during short-term waterlogging, but observed adverse effects during the recovery phase, with even short-term (as few as 3 d) waterlogging showing clear effects on plant growth. In the present study, we observed no morphological differences after 3 d of submergence, but the physiological effects differed between wild-type and transgenic plants.
    Under submergence conditions, leaf chlorophyll decreased significantly in plants [51]and [52]. Waterlogging also resulted in decreased chlorophyll content in both waterlogging-tolerant and -susceptible pigeon pea (Cajanus cajan L.) [53]. In the present study, the chlorophyll content decreased in both wild type and transgenic plants after submergence, but the chlorophyll level was higher in the two transgenic lines than in the wild type. Plants grown in waterlogged fields can suffer hypoxic stress, leading to degradation of chlorophyll [3]. The wild type suffered more from submergence stress, showing yellow and withered leaves, whereas BnERF2.4-overexpressing Arabidopsis lines showed slower chlorophyll degradation. Soluble sugar serves as an energy source and as signaling molecules that can activate transduction pathways [54] and can enhance plant tolerance to multiple stresses. Exogenous sucrose greatly enhanced anoxia tolerance of Arabidopsis seedlings [55]. Waterlogging also caused an increase in reducing sugars in a tolerant line of Vigna radiata [56]. In the present study, an immediate increase in soluble sugar after submergence treatment was observed in transgenic Arabidopsis, in contrast to an initial decrease in wild-type plants. Wild-type and transgenic plants had similar soluble sugar contents after 3 d of submergence and 1 d of recovery. It is likely that the BnERF2.4 overexpression enhanced soluble sugar content, which not only can be used as an energy source, but also is involved in signaling pathways. Soluble sugar can also enhance submergence resistance by adjusting osmotic potential. Zhang et al. [20] reported higher levels of soluble sugars in GmERF3-overexpressing tobacco than in wild-type plants under non-stressed and drought-stress conditions. Similarly, Wu et al. [23] found that the expression levels of osmotic stress genes were higher in JERF3-overexpressing tobacco, including genes involved in sugar synthesis.
    Waterlogging disrupts the balance between production and scavenging of ROS and induces oxidative damage in plants [5], [46] and [57]. H2O2 and O2•− levels accumulated in leaves were measured using DAB and NBT staining methods. The leaves of transgenic Arabidopsis accumulated less H2O2 and O2•− than those of the wild type. Transgenic Arabidopsis also had lower MDA content, which was directly linked to ROS accumulation. MDA level is considered to be a measure of lipid peroxidation status and can be used as an indicator of plant oxidative damage [58]and [59]. Plant MDA contents gradually increased with flooding duration [60]. In the present study, during the 3 d submergence treatment, MDA content in wild-type Arabidopsis increased significantly to 1.6 times the control level. However, MDA content in transgenic Arabidopsis did not change over the entire treatment period, indicating that wild-type Arabidopsis suffered greater damage than transgenic plants during the submergence treatment. Zhang et al. [24] reported higher MDA contents in aterf98 mutant than wild-type plants, and ATERF98-overexpressing Arabidopsisaccumulated less MDA than wild-type plants under salt stress conditions. Thus, overexpression of ERF genes in plants may inhibit ROS generation and accumulation pathways, leading to lower MDA contents in plants.
    Activation of antioxidant enzymes may provide another method for ERF-overexpressing transgenic plants in their defense against stress. When plants suffer oxidative damage, the antioxidant enzyme system plays an important role in the process of scavenging ROS [53] and [61]. SOD is the first line of antioxidant defense [62]. A short duration of hypoxia enhanced the activities of SOD, CAT, ascorbate peroxidase (APX), and glutathione reductase (GR) in Zea mays leaves [59]. Waterlogging treatment before anthesis was found to increase activities of SOD, APX, and CAT in enhancing tolerance to waterlogging after anthesis in wheat [63]. In the present study, activities of SOD, POD, and CAT increased after submergence in both wild-type and transgenic plants. But the activities of these enzymes were higher in transgenic lines than in the wild type even under normal conditions. Our results also showed a higher expression of antioxidant enzyme genes with the overexpression of BnERF2.4. A similar phenomenon was observed in JERF3-overexpressing tobacco. The expression of JERF3 in tobacco increased the activity of SOD and decreased the accumulation of ROS [23], JERF3 activated the expression of NtSOD by interacting with the GCC box in the NtSOD promoter. Our present study provides new evidence that BnERF2.4 activates the antioxidant system and protects plants from oxidative damage. However, the mechanism by which BnERF2.4 regulates downstream genes is still unknown.
    In conclusion, the present study has provided further evidence that BnERF2.4 plays an important role in defense against submergence stress. Regulation of the antioxidant system is probably one of the mechanisms.

    Acknowledgments

    This work was supported by the Natural Science Foundation of Jiangsu, China(BK2011668), the China Agriculture Research System (CARS-13) and the National Key Technology Research and Development Program of China (2010-BAD01B10).

    References

      • [1]
      • A. Maryam, S. Nasreen
      • A review: water logging effects on morphological, anatomical, physiological and biochemical attributes of food and cash crops
      • Int. J. Water. Resour. Environ. Sci., Volume 1, 2012, pp. 113–120
      • View Record in Scopus
        Citing articles (1)
      • [2]
      • F. Ahmed, M.Y. Rafii, M.R. Ismail, A.S. Juraimi, H.A. Rahim, R. Asfaliza, M.A. Latif
      • Waterlogging tolerance of crops: breeding, mechanism of tolerance, molecular approaches, and future prospects
      • Biomed. Res. Int., Volume 963525, 2013
      • [3]
      • M.B. Jackon, T.D. Colmer
      • Response and adaptation by plants to flooding stress
      • Ann. Bot., Volume 96, 2005, pp. 501–505
      • [4]
      • M.A. Ashraf
      • Waterlogging stress in plants: a review
      • Afr. J. Agric. Res., Volume 7, 2012, pp. 1976–1981
      • View Record in Scopus
        Citing articles (14)
      • [5]
      • M. Irfan, S. Hayat, Q. Hayat, S. Afroz, A. Ahmad
      • Physiological and biochemical changes in plants under waterlogging
      • Protoplasma, Volume 241, 2010, pp. 3–17
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (37)
      • [6]
      • E.S. Dennis, R. Dolferus, M. Ellis, M. Rahman, Y. Wu, F.U. Hoeren, A. Grover, K.P. Ismond, A.G. Good, W.J. Peacock
      • Molecular strategies for improving waterlogging tolerance in plants
      • J. Exp. Bot., Volume 51, 2000, pp. 89–97
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (189)
      • [7]
      • V.P. Grichko, B.R. Glick
      • Ethylene and flooding stress in plants
      • Plant Physiol. Biochem., Volume 39, 2001, pp. 1–9
      • Article
         | 
         PDF (56 K)
         | 
        View Record in Scopus
        Citing articles (53)
      • [8]
      • M.A. Hossain, S.N. Uddin
      • Mechanisms of waterlogging tolerance in wheat: morphological and metabolic adaptations under hypoxia or anoxia
      • Aust. J. Crop. Sci., Volume 5, 2011, pp. 1094–1101
      • [9]
      • P. Verboven, O. Pedersen, E. Herremans, Q.T. Ho, B.M. Nicolaï, T.D. Colmer, N. Teakle
      • Root aeration via aerenchymatous phellem: three-dimensional micro-imaging and radial O2 profiles in Melilotus siculus
      • New. Phytol., Volume 193, 2012, pp. 420–431
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (24)
      • [10]
      • K. Shiono, S. Ogawa, S. Yamazaki, H. Isoda, T. Fujimura, M. Nakazono, T.D. Colmer
      • Contrasting dynamics of radial O2-loss barrier induction and aerenchyma formation in rice roots of two lengths
      • Ann. Bot., Volume 107, 2011, pp. 89–99
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (34)
      • [11]
      • D.M. Yin, S.M. Chen, F.D. Chen, J.F. Jiang
      • Ethylene promotes induction of aerenchyma formation and ethanolic fermentation in waterlogged roots of Dendranthema spp
      • Mol. Biol. Rep., Volume 40, 2013, pp. 4581–4590
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (5)
      • [12]
      • Z.S. Xu, M. Chen, L.C. Li, Y.Z. Ma
      • Functions of the ERF transcription factor family in plants
      • Botany, Volume 86, 2008, pp. 969–977
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (39)
      • [13]
      • G.Y. Zhang, M. Chen, X.P. Chen, Z.S. Xu, S. Guan, L.C. Li, A.L. Li, J.M. Guo, L. Mao, Y.Z. Ma
      • Phylogeny, gene structures, and expression patters of the ERF gene family in soybean (Glycine max L.)
      • J. Exp. Bot., Volume 59, 2008, pp. 4095–4107
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (96)
      • [14]
      • T. Nakano, K. Suzuki, T. Fujimura, H. Shinshi
      • Genome-wide analysis of the ERF gene family in Arabidopsis and rice
      • Plant Physiol., Volume 140, 2006, pp. 411–432
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (647)
      • [15]
      • Y. Sakuma, Q. Liu, J.G. Dubouzet, H. Abe, K. Shinozaki, K. Yamaguchi-Shinozaki
      • DNA-binding specificity of ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration-and cold-inducible gene expression
      • Biochem. Biophys. Res. Commun., Volume 290, 2002, pp. 998–1009
      • Article
         | 
         PDF (561 K)
         | 
        View Record in Scopus
        Citing articles (692)
      • [16]
      • Y.F. Cao, F.M. Song, R.M. Goodman, Z. Zheng
      • Molecular characterization of four rice genes encoding ethylene-responsive transcriptional factors and their expressions in response to biotic and abiotic stress
      • J. Plant Physiol., Volume 163, 2006, pp. 1167–1178
      • Article
         | 
         PDF (420 K)
         | 
        View Record in Scopus
        Citing articles (63)
      • [17]
      • A.M. Sharoni, M. Nuruzzaman, K. Satoh, T. Shimizu, H. Kondoh, T. Sasaya, I.R. Choi, T. Omura, S. Kikuchi
      • Gene structure, classification and expression models of the AP2/EREBP transcription factor family in rice
      • Plant. Cell. Physiol., Volume 52, 2011, pp. 344–360
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (88)
      • [18]
      • L. Oñate-Sánchez, K.B. Singh
      • Identification of Arabidopsis ethylene-responsive element binding factors with distinct induction kinetics after pathogen infection
      • Plant Physiol., Volume 128, 2002, pp. 1313–1322
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (129)
      • [19]
      • J. Zhuang, J.M. Chen, Q.H. Yao, F. Xiong, C.C. Sun, X.R. Zhou, J. Zhang, A.S. Xiong
      • Discovery and expression profile analysis of AP2/ERF family genes from Triticum aestivum
      • Mol. Biol. Rep., Volume 38, 2011, pp. 745–753
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (42)
      • [20]
      • G.Y. Zhang, M. Chen, L.C. Li, Z.S. Xu, X.P. Chen, J.M. Guo, Y.Z. Ma
      • Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought and diseases in transgenic tobacco
      • J. Exp. Bot., Volume 60, 2009, pp. 3781–3796
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (137)
      • [21]
      • H.W. Zhang, W. Liu, L.Y. Wan, F. Li, L.Y. Dai, D.J. Li, Z.J. Zhang, R.F. Huang
      • Functional analyses of ethylene response factor JERF3 with the aim of improving tolerance to drought and osmotic stress in transgenic rice
      • Transgenic Res., Volume 19, 2010, pp. 809–818
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (27)
      • [22]
      • Z.J. Zhang, F. Li, D.J. Li, H.W. Zhang, R.F. Huang
      • Expression of ethylene response factor JERF1 in rice improves tolerance to drought
      • Planta, Volume 232, 2010, pp. 765–774
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (41)
      • [23]
      • L.J. Wu, Z.J. Zhang, H.W. Zhang, X.C. Wang, R.F. Huang
      • Transcriptional modulation of ethylene response factor protein JERF3 in the oxidative stress response enhances tolerance of tobacco seedlings to salt, drought, and freezing
      • Plant Physiol., Volume 148, 2008, pp. 1953–1963
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (96)
      • [24]
      • Z.J. Zhang, J. Wang, R.X. Zhang, R.F. Huang
      • The ethylene response factor AtERF98 enhances tolerance to salt through the transcriptional activation of ascorbic acid synthesis in Arabidopsis
      • Plant. J., Volume 71, 2012, pp. 273–287
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (41)
      • [25]
      • K.N. Xu, X. Xu, T. Fukao, P. Canlas, R. Maghirang-Rodriguez, S. Heuer, A.M. Ismail, J. Bailey-Serres, P.C. Ronald, D.J. Mackill
      • Sub1A is an ethylene-response-factor-like gene that confers submergence tolerance to rice
      • Nature, Volume 442, 2006, pp. 705–708
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (534)
      • [26]
      • T. Fukao, K.N. Xu, P.C. Ronald, J. Bailey-Serres
      • A variable cluster of ethylene response factor-like genes regulates metabolic and developmental acclimation responses to submergence in rice
      • Plant Cell, Volume 18, 2006, pp. 2021–2034
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (255)
      • [27]
      • T. Fukao, J. Bailey-Serres
      • Submergence tolerance conferred by Sub1A is mediated by SLR1 and SLRL1 restriction of gibberellin responses in rice
      • Proc. Natl. Acad. Sci. U. S. A., Volume 105, 2008, pp. 16814–16819
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (130)
      • [28]
      • F. Licausi, J.T. van Dongen, B. Giuntoli, G. Novi, A. Santaniello, P. Geigenberger, P. Perata
      • HRE1 and HRE2, two hypoxia-inducible ethylene response factors, affect anaerobic responses in Arabidopsis thaliana
      • Plant. J., Volume 62, 2010, pp. 302–315
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (132)
      • [29]
      • S.Y. Fujimoto, M. Ohta, A. Usui, H. Shinshi, M. Ohme-Takagi
      • Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box-mediated gene expression
      • Plant Cell, Volume 12, 2000, pp. 393–404
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (558)
      • [30]
      • S. Dey, A. Corina Vlot
      • Ethylene responsive factors in the orchestration of stress responses in monocotyledonous plants
      • Front. Plant Sci., Volume 6, 2015, pp. 1–7
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1)
      • [31]
      • L.V. Savitch, G. Allard, M. Seki, L.S. Robert, N.A. Tinker, N.P.A. Huner, K. Shinozaki, J. Singh
      • The effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus
      • Plant Cell Physiol., Volume 46, 2005, pp. 1525–1539
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (77)
      • [32]
      • A.S. Xiong, H.H. Jiang, J. Zhuang, R.H. Peng, X.F. Jin, B. Zhu, F. Wang, J. Zhang, Q.H. Yao
      • Expression and function of a modified AP2/ERF transcription factor from Brassica napus enhances cold tolerance in transgenic Arabidopsis
      • Mol. Biotechnol., Volume 53, 2013, pp. 198–206
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (16)
      • [33]
      • S.J. Clough, A.F. Bent
      • Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana
      • Plant J., Volume 16, 1998, pp. 735–743
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (8752)
      • [34]
      • R.A. Jefferson, T.A. Kayanagh, M.W. Bevan
      • GUS fusion: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants
      • EMBO. J., Volume 6, 1987, pp. 3901–3907
      • View Record in Scopus
        Citing articles (6166)
      • [35]
      • R.L. Heath, L. Packer
      • Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation
      • Arch. Biochem. Biophys., Volume 125, 1968, pp. 189–198
      • Article
         | 
         PDF (858 K)
         | 
        View Record in Scopus
        Citing articles (3207)
      • [36]
      • M.C. Romero-Puertas, M. Rodríguez-Serrano, F.J. Corpas, M. Gómez, L.A. Del Río, L.M. Sandalio
      • Cadmium-induced subcellular accumulation of O2– and H2O2 in pea leaves
      • Plant. Cell. Environ., Volume 27, 2004, pp. 1122–1134
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (341)
      • [37]
      • C.N. Giannopolitis, S.K. Ries
      • Superoxide dismutase. I. Occurrence in high plants
      • Plant. Physiol., Volume 59, 1977, pp. 309–314
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1)
      • [38]
      • H. Aebi
      • Catalase in vitro
      • Method. Enzymol., Volume 105, 1984, pp. 121–126
      • Article
         | 
         PDF (305 K)
         | 
        View Record in Scopus
        Citing articles (8452)
      • [39]
      • X. Zheng, R.B. Van Huystee
      • Peroxidase-regulated elongation of segments from peanut hypocotyls
      • Plant Sci., Volume 81, 1992, pp. 47–56
      • Article
         | 
         PDF (760 K)
         | 
        View Record in Scopus
        Citing articles (92)
      • [40]
      • Q.Y. Tang, C.X. Zhang
      • Data processing system (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research
      • Insect Sci., Volume 20, 2013, pp. 254–260
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (117)
      • [41]
      • K.R. Jaglo, S. Kleff, K.L. Amundsen, X. Zhang, V. Haake, J.Z. Zhang, T. Deits, M.F. Thomashow
      • Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold-response pathway are conserved in Brassica napus and other plant species
      • Plant Physiol., Volume 127, 2001, pp. 910–917
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (387)
      • [42]
      • T.J. Zhao, S. Sun, Y. Liu, J.M. Liu, Q. Liu, Y.B. Yan, H.M. Zhou
      • Regulating the drought-responsive element (DRE)-mediated signaling pathway by synergic functions of trans-active and trans-inactive DRE binding factors in Brassica napus
      • J. Biol. Chem., Volume 281, 2006, pp. 10752–10759
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (56)
      • [43]
      • M. Berrocal-Lobo, A. Molina, R. Solano
      • Constitutive expression of ethylene-response-factor1 in Arabidopsis confers resistance to several necrotrophic fungi
      • Plant J., Volume 29, 2002, pp. 23–32
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (347)
      • [44]
      • M. Berrocal-Lobo, A. Molina
      • Ethylene response factor 1 mediates Arabidopsis resistance to the soilborne fungus Fusarium oxysporum
      • Mol. Plant-Microbe Interact., Volume 17, 2004, pp. 763–770
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (130)
      • [45]
      • U. Fischer, W. Dröge-Laser
      • Overexpression of NtERF5, a new member of the tobacco ethylene response transcription factor family enhances resistance to tobacco mosaic virus
      • Mol. Plant-Microbe Interact., Volume 17, 2004, pp. 1162–1171
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (64)
      • [46]
      • R.K. Sairam, D. Kumutha, K. Ezhilmathi, V. Chinnusamy, R.C. Meena
      • Waterlogging induced oxidative stress and antioxidant enzyme activities in pigeon pea
      • Biol. Plantarum, Volume 53, 2009, pp. 493–504
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (25)
      • [47]
      • M.C. Drew, E.J. Sisworo
      • Early effects of flooding on nitrogen deficiency and leaf chlorosis in barley
      • New Phytol., Volume 79, 1977, pp. 567–571
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (40)
      • [48]
      • O. Blokhina, E. Virolainen, K.V. Fagerstedt
      • Antioxidants, oxidative damage and oxygen deprivation stress: a review
      • Ann. Bot., Volume 91, 2003, pp. 179–194
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (1533)
      • [49]
      • W.J. Zhou, X.Q. Lin
      • Effects of waterlogging at different growth stages on physiological characteristics and seed yield of winter rape (Brassica napus L.)
      • Field Crops. Res., Volume 44, 1995, pp. 103–110
      • Article
         | 
         PDF (516 K)
         | 
        View Record in Scopus
        Citing articles (41)
      • [50]
      • A.I. Malik, T.D. Colmer, H. Lambers, T.L. Setter, M. Schortemeyer
      • Short-term waterlogging has long-term effects on the growth and physiology of wheat
      • New. Phytol., Volume 153, 2002, pp. 225–236
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (97)
      • [51]
      • S. Ahmed, E. Nawata, M. Hosokawa, Y. Domae, T. Sakuratani
      • Alterations in photosynthesis and some antioxidant enzymatic activities of mungbean subjected to waterlogging
      • Plant. Sci., Volume 163, 2002, pp. 117–123
      • Article
         | 
         PDF (172 K)
         | 
        View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (71)
      • [52]
      • D. Kumutha, R.K. Sairam, K. Ezhilmathi, V. Chinnusamy, R.C. Meena
      • Effect of waterlogging on carbohydrate metabolism in pigeon pea (Cajanus cajanL.) Upregulation of sucrose synthase an alcohol dehydrogenase
      • Plant Sci., Volume 175, 2008, pp. 706–716
      • Article
         | 
         PDF (3407 K)
         | 
        View Record in Scopus
        Citing articles (26)
      • [53]
      • D. Kumutha, K. Ezhilmathi, R.K. Sairam, G.C. Srivastava, P.S. Deshmukh, R.C. Meena
      • Waterlogging induced oxidative stress and antioxidant activity in pigeonpea genotypes
      • Biol. Plantarum, Volume 53, 2009, pp. 75–84
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (42)
      • [54]
      • I. Couée, C. Sulmon, G. Gouesbet, A.E. Amrani
      • Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants
      • J. Exp. Bot., Volume 57, 2006, pp. 449–459
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (260)
      • [55]
      • E. Loreti, A. Poggi, G. Novi, A. Alpi, P. Perata
      • A genome-wide analysis of the effects of sucrose on gene expression in Arabidopsis seedlings under anoxia
      • Plant Physiol., Volume 137, 2005, pp. 1130–1138
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (173)
      • [56]
      • R.K. Sairam, K. Dharmal, V. Chinnusamy, R.C. Meena
      • Waterlogging-induced increase in sugar mobilization, fermentation, and related gene expression in the roots of mung bean (Vigna radiata)
      • J. Plant Physiol., Volume 166, 2009, pp. 602–616
      • Article
         | 
         PDF (706 K)
         | 
        View Record in Scopus
        Citing articles (48)
      • [57]
      • G.P. Zhang, K. Tanakamaru, J. Abe, S. Morita
      • Influence of waterlogging on some anti-oxidative enzymatic activities of two barley genotypes differing in anoxia tolerance
      • Acta Physiol. Plant., Volume 29, 2007, pp. 171–176
      • View Record in Scopus
         | 
        Full Text via CrossRef
        Citing articles (17)
      • [58]
      • L.J. Marnett
      • Oxy radicals, lipid peroxidation and DNA damage
      • Toxicology, Volume 181–182, 2002, pp. 219–222
      • Article
         | 
         PDF (89 K)
         | 
        View Record in Scopus
        Citing articles (314)
      • [59]
      • M. Choudhary, U.K. Jetley, M.A. Khan, S. Zutshi, T. Fatma
      • Effect of heavy metal stress on proline, malondialdehyde, and superoxide dismutase activity in the cyanobacterium Spirulina platensis-S5
      • Ecotox. Environ. Safe., Volume 66, 2007, pp. 204–209
      • Article
         | 
         PDF (379 K)
         | 
        View Record in Scopus
        Citing articles (129)
      • [60]
      • R. Jamei, R. Heidari, J. Khara, S. Zare
      • Hypoxia induced changes in the lipid peroxidation, membrane permeability, reactive oxygen species generation, and antioxidant response systems in Zea mays leaves
      • Turk. J. Biol., Volume 33, 2009, pp. 45–52
      • View Record in Scopus
        Citing articles (5)
      • [61]
      • Z. Hossain, M.F. López-Climent, V. Arbona, R.M. Pérez-Clemente, A. Gómez-Cadenas
      • Modulation of the antioxidant system in citrus under waterlogging and subsequent drainage
      • J. Plant Physiol., Volume 166, 2009, pp. 1391–1404
      • View article
      • [62]
      • K. Apel, H. Hirt
      • Reactive oxygen species: metabolism, oxidative stress, and signal transduction
      • Annu. Rev. Plant Biol., Volume 55, 2004, pp. 373–399
      • View article
      • [63]
      • C. Li, D. Jiang, B. Wollenweber, Y. Li, T. Dai, W. Cao
      • Waterlogging pretreatment during vegetative growth improves tolerance to waterlogging after anthesis in wheat
      • Plant Sci., Volume 180, 2011, pp. 672–678
      • View article
    • ☆
      Peer review under responsibility of Crop Science Society of China and Institute of Crop Science, CAAS.
    • ⁎ 
      Corresponding author at: Institute of Industrial Crops, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China.


    For further details log on website :
    http://www.sciencedirect.com/science/article/pii/S2214514116000180
    at July 24, 2016
    Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest

    No comments:

    Post a Comment

    Newer Post Older Post Home
    Subscribe to: Post Comments (Atom)

    Advantages and Disadvantages of Fasting for Runners

    Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...

    • Pengalaman bekerja sebagai kerani kilang.
      Assalamualaikum dan salam sejahtera chu olls.     Alhamdulillah sudah seminggu saya melalui pengalaman bermakna ini. Sebagai seorang pel...
    • MIDA- INDUSTRI BERASASKAN KAYU
      Industri berasaskan kayu di Malaysia terdiri daripada  Kayu bergergaji; Venir dan produk panel yang termasuk papan lapis dan produk ...
    • Advantages and Disadvantages of Fasting for Runners
      Author BY   ANDREA CESPEDES  Food is fuel, especially for serious runners who need a lot of energy. It may seem counterintuiti...
    • UKIRAN KAYU DALAM MASYARAKAT MELAYU
      Seni ukiran kayu di kalangan masyarakat Melayu bukan sahaja terdapat pada rumah-rumah tetapi penjelmaan dan penerapannya terdapat pada is...
    • Laboratory Assessment of Forest Soil Respiration Affected by Wildfires under Various Environments of Russia
      International Journal of Ecology Volume 2017 (2017), Article ID 3985631, 10 pages https://doi.org/10.1155/2017/3985631 Author Evgeny  ...
    • Diploma Teknologi Berasaskan Kayu
      LATARBELAKANG POLITEKNIK KOTA KINABALU Politeknik Kota Kinabalu merupakan politeknik yang ketujuh ditubuhkan oleh Kementerian Pendidikan...
    • DIPLOMA REKA BENTUK PERABUT
      Sijil Teknologi Diploma Rekabentuk Perabot Kod Kursus :  K18 ...
    • Motif, Corak dan Ragi Tenun Melayu Riau
      Author MELAYU Riau kaya dengan khazanah budayanya. Antaranya yang amat menonjol adalah motif ornamen Melayunya, yang banyak dipakai untuk ...
    • RUBBER AND PVC FETISHISM
      Rubber fetishism , or  latex fetishism , is the fetishistic attraction to people wearing latex clothing or, in certain cases, to the garme...
    • 5 Jenama Foundation Terbaik, Beli Di Farmasi Je!
      Beberapa minggu sudah, penulis pernah mencadangkan beberapa jenama maskara terbaik yang mudah didapati pada harga berpatutan dari farmas...

    nuffnang ads

    Search This Blog

    Pages

    • Home

    About Me

    Unknown
    View my complete profile

    Blog Archive

    • ►  2018 (371)
      • ►  June (17)
        • ►  Jun 22 (8)
        • ►  Jun 12 (1)
        • ►  Jun 11 (2)
        • ►  Jun 05 (6)
      • ►  May (6)
        • ►  May 31 (6)
      • ►  April (75)
        • ►  Apr 30 (1)
        • ►  Apr 27 (1)
        • ►  Apr 26 (15)
        • ►  Apr 25 (10)
        • ►  Apr 24 (11)
        • ►  Apr 18 (2)
        • ►  Apr 12 (4)
        • ►  Apr 10 (5)
        • ►  Apr 09 (9)
        • ►  Apr 05 (17)
      • ►  March (65)
        • ►  Mar 27 (7)
        • ►  Mar 22 (2)
        • ►  Mar 20 (4)
        • ►  Mar 13 (14)
        • ►  Mar 12 (11)
        • ►  Mar 08 (7)
        • ►  Mar 06 (1)
        • ►  Mar 05 (1)
        • ►  Mar 01 (18)
      • ►  February (103)
        • ►  Feb 28 (25)
        • ►  Feb 27 (27)
        • ►  Feb 26 (10)
        • ►  Feb 20 (1)
        • ►  Feb 19 (9)
        • ►  Feb 09 (13)
        • ►  Feb 06 (6)
        • ►  Feb 05 (5)
        • ►  Feb 02 (7)
      • ►  January (105)
        • ►  Jan 25 (11)
        • ►  Jan 23 (5)
        • ►  Jan 16 (6)
        • ►  Jan 15 (9)
        • ►  Jan 14 (7)
        • ►  Jan 10 (1)
        • ►  Jan 09 (2)
        • ►  Jan 08 (4)
        • ►  Jan 04 (24)
        • ►  Jan 03 (2)
        • ►  Jan 02 (21)
        • ►  Jan 01 (13)
    • ►  2017 (6160)
      • ►  December (11)
        • ►  Dec 30 (11)
      • ►  November (31)
        • ►  Nov 26 (9)
        • ►  Nov 07 (8)
        • ►  Nov 06 (3)
        • ►  Nov 01 (11)
      • ►  October (345)
        • ►  Oct 31 (4)
        • ►  Oct 25 (42)
        • ►  Oct 24 (5)
        • ►  Oct 23 (15)
        • ►  Oct 22 (3)
        • ►  Oct 18 (7)
        • ►  Oct 17 (27)
        • ►  Oct 16 (14)
        • ►  Oct 15 (6)
        • ►  Oct 13 (18)
        • ►  Oct 12 (44)
        • ►  Oct 11 (57)
        • ►  Oct 09 (47)
        • ►  Oct 06 (14)
        • ►  Oct 05 (1)
        • ►  Oct 04 (13)
        • ►  Oct 03 (17)
        • ►  Oct 02 (11)
      • ►  September (186)
        • ►  Sept 29 (3)
        • ►  Sept 26 (7)
        • ►  Sept 25 (18)
        • ►  Sept 21 (29)
        • ►  Sept 20 (10)
        • ►  Sept 19 (11)
        • ►  Sept 18 (2)
        • ►  Sept 14 (19)
        • ►  Sept 13 (28)
        • ►  Sept 11 (3)
        • ►  Sept 10 (15)
        • ►  Sept 08 (5)
        • ►  Sept 06 (22)
        • ►  Sept 05 (14)
      • ►  August (158)
        • ►  Aug 29 (10)
        • ►  Aug 28 (73)
        • ►  Aug 27 (2)
        • ►  Aug 21 (4)
        • ►  Aug 18 (17)
        • ►  Aug 17 (4)
        • ►  Aug 14 (13)
        • ►  Aug 11 (5)
        • ►  Aug 10 (4)
        • ►  Aug 09 (7)
        • ►  Aug 08 (1)
        • ►  Aug 06 (3)
        • ►  Aug 04 (2)
        • ►  Aug 03 (13)
      • ►  July (290)
        • ►  Jul 26 (9)
        • ►  Jul 25 (7)
        • ►  Jul 24 (25)
        • ►  Jul 23 (5)
        • ►  Jul 21 (13)
        • ►  Jul 18 (19)
        • ►  Jul 17 (18)
        • ►  Jul 14 (17)
        • ►  Jul 13 (75)
        • ►  Jul 12 (10)
        • ►  Jul 11 (64)
        • ►  Jul 10 (26)
        • ►  Jul 09 (2)
      • ►  June (522)
        • ►  Jun 30 (1)
        • ►  Jun 27 (3)
        • ►  Jun 22 (13)
        • ►  Jun 21 (41)
        • ►  Jun 20 (3)
        • ►  Jun 19 (68)
        • ►  Jun 16 (33)
        • ►  Jun 15 (87)
        • ►  Jun 13 (25)
        • ►  Jun 12 (26)
        • ►  Jun 09 (20)
        • ►  Jun 08 (60)
        • ►  Jun 07 (54)
        • ►  Jun 06 (53)
        • ►  Jun 05 (35)
      • ►  May (684)
        • ►  May 31 (6)
        • ►  May 22 (3)
        • ►  May 21 (14)
        • ►  May 20 (12)
        • ►  May 19 (3)
        • ►  May 18 (26)
        • ►  May 17 (63)
        • ►  May 16 (27)
        • ►  May 15 (25)
        • ►  May 14 (16)
        • ►  May 07 (9)
        • ►  May 06 (26)
        • ►  May 05 (74)
        • ►  May 04 (126)
        • ►  May 03 (51)
        • ►  May 02 (153)
        • ►  May 01 (50)
      • ►  April (759)
        • ►  Apr 29 (56)
        • ►  Apr 28 (37)
        • ►  Apr 27 (67)
        • ►  Apr 26 (87)
        • ►  Apr 25 (6)
        • ►  Apr 10 (4)
        • ►  Apr 09 (5)
        • ►  Apr 08 (78)
        • ►  Apr 07 (57)
        • ►  Apr 06 (52)
        • ►  Apr 05 (53)
        • ►  Apr 04 (43)
        • ►  Apr 03 (94)
        • ►  Apr 02 (28)
        • ►  Apr 01 (92)
      • ►  March (1744)
        • ►  Mar 31 (90)
        • ►  Mar 30 (74)
        • ►  Mar 29 (58)
        • ►  Mar 28 (50)
        • ►  Mar 27 (95)
        • ►  Mar 26 (58)
        • ►  Mar 25 (98)
        • ►  Mar 24 (94)
        • ►  Mar 23 (77)
        • ►  Mar 22 (43)
        • ►  Mar 21 (54)
        • ►  Mar 20 (43)
        • ►  Mar 19 (88)
        • ►  Mar 18 (65)
        • ►  Mar 17 (63)
        • ►  Mar 16 (94)
        • ►  Mar 15 (79)
        • ►  Mar 14 (35)
        • ►  Mar 11 (10)
        • ►  Mar 10 (43)
        • ►  Mar 09 (40)
        • ►  Mar 08 (27)
        • ►  Mar 07 (40)
        • ►  Mar 06 (62)
        • ►  Mar 05 (48)
        • ►  Mar 04 (63)
        • ►  Mar 03 (54)
        • ►  Mar 02 (13)
        • ►  Mar 01 (86)
      • ►  February (715)
        • ►  Feb 28 (10)
        • ►  Feb 27 (61)
        • ►  Feb 26 (31)
        • ►  Feb 24 (22)
        • ►  Feb 23 (31)
        • ►  Feb 22 (42)
        • ►  Feb 21 (30)
        • ►  Feb 20 (42)
        • ►  Feb 19 (43)
        • ►  Feb 18 (46)
        • ►  Feb 17 (39)
        • ►  Feb 16 (39)
        • ►  Feb 15 (24)
        • ►  Feb 14 (54)
        • ►  Feb 13 (25)
        • ►  Feb 12 (78)
        • ►  Feb 10 (53)
        • ►  Feb 09 (22)
        • ►  Feb 01 (23)
      • ►  January (715)
        • ►  Jan 30 (25)
        • ►  Jan 28 (19)
        • ►  Jan 27 (36)
        • ►  Jan 26 (27)
        • ►  Jan 24 (27)
        • ►  Jan 22 (22)
        • ►  Jan 21 (58)
        • ►  Jan 20 (20)
        • ►  Jan 19 (30)
        • ►  Jan 18 (39)
        • ►  Jan 17 (26)
        • ►  Jan 16 (36)
        • ►  Jan 15 (62)
        • ►  Jan 14 (22)
        • ►  Jan 13 (20)
        • ►  Jan 12 (33)
        • ►  Jan 11 (32)
        • ►  Jan 10 (26)
        • ►  Jan 05 (11)
        • ►  Jan 04 (22)
        • ►  Jan 03 (35)
        • ►  Jan 02 (34)
        • ►  Jan 01 (53)
    • ▼  2016 (6885)
      • ►  December (986)
        • ►  Dec 31 (12)
        • ►  Dec 30 (23)
        • ►  Dec 29 (15)
        • ►  Dec 28 (29)
        • ►  Dec 27 (32)
        • ►  Dec 26 (29)
        • ►  Dec 25 (39)
        • ►  Dec 24 (43)
        • ►  Dec 23 (29)
        • ►  Dec 22 (28)
        • ►  Dec 21 (46)
        • ►  Dec 20 (28)
        • ►  Dec 19 (36)
        • ►  Dec 18 (14)
        • ►  Dec 17 (24)
        • ►  Dec 16 (10)
        • ►  Dec 15 (43)
        • ►  Dec 14 (55)
        • ►  Dec 13 (38)
        • ►  Dec 12 (45)
        • ►  Dec 11 (26)
        • ►  Dec 10 (48)
        • ►  Dec 09 (34)
        • ►  Dec 08 (22)
        • ►  Dec 07 (29)
        • ►  Dec 06 (15)
        • ►  Dec 05 (45)
        • ►  Dec 04 (38)
        • ►  Dec 03 (41)
        • ►  Dec 02 (41)
        • ►  Dec 01 (29)
      • ►  November (600)
        • ►  Nov 30 (38)
        • ►  Nov 29 (36)
        • ►  Nov 28 (43)
        • ►  Nov 27 (22)
        • ►  Nov 26 (27)
        • ►  Nov 25 (39)
        • ►  Nov 24 (27)
        • ►  Nov 23 (37)
        • ►  Nov 22 (21)
        • ►  Nov 21 (32)
        • ►  Nov 20 (20)
        • ►  Nov 19 (31)
        • ►  Nov 18 (34)
        • ►  Nov 17 (29)
        • ►  Nov 16 (21)
        • ►  Nov 15 (33)
        • ►  Nov 14 (16)
        • ►  Nov 13 (3)
        • ►  Nov 12 (3)
        • ►  Nov 11 (1)
        • ►  Nov 09 (2)
        • ►  Nov 07 (14)
        • ►  Nov 04 (16)
        • ►  Nov 03 (17)
        • ►  Nov 02 (23)
        • ►  Nov 01 (15)
      • ►  October (374)
        • ►  Oct 31 (15)
        • ►  Oct 30 (2)
        • ►  Oct 29 (4)
        • ►  Oct 28 (25)
        • ►  Oct 27 (19)
        • ►  Oct 26 (16)
        • ►  Oct 25 (11)
        • ►  Oct 24 (14)
        • ►  Oct 23 (12)
        • ►  Oct 21 (14)
        • ►  Oct 20 (19)
        • ►  Oct 19 (21)
        • ►  Oct 18 (17)
        • ►  Oct 17 (15)
        • ►  Oct 16 (20)
        • ►  Oct 15 (12)
        • ►  Oct 14 (11)
        • ►  Oct 13 (21)
        • ►  Oct 12 (13)
        • ►  Oct 11 (6)
        • ►  Oct 10 (12)
        • ►  Oct 09 (17)
        • ►  Oct 08 (10)
        • ►  Oct 07 (11)
        • ►  Oct 06 (19)
        • ►  Oct 05 (13)
        • ►  Oct 03 (5)
      • ►  September (406)
        • ►  Sept 29 (6)
        • ►  Sept 28 (2)
        • ►  Sept 27 (12)
        • ►  Sept 16 (20)
        • ►  Sept 15 (34)
        • ►  Sept 14 (39)
        • ►  Sept 13 (32)
        • ►  Sept 12 (36)
        • ►  Sept 11 (18)
        • ►  Sept 10 (16)
        • ►  Sept 07 (6)
        • ►  Sept 06 (26)
        • ►  Sept 05 (14)
        • ►  Sept 04 (44)
        • ►  Sept 03 (17)
        • ►  Sept 02 (38)
        • ►  Sept 01 (46)
      • ►  August (777)
        • ►  Aug 31 (13)
        • ►  Aug 29 (22)
        • ►  Aug 28 (13)
        • ►  Aug 27 (26)
        • ►  Aug 26 (18)
        • ►  Aug 25 (14)
        • ►  Aug 24 (13)
        • ►  Aug 23 (22)
        • ►  Aug 22 (23)
        • ►  Aug 21 (20)
        • ►  Aug 20 (23)
        • ►  Aug 19 (13)
        • ►  Aug 18 (31)
        • ►  Aug 17 (36)
        • ►  Aug 16 (17)
        • ►  Aug 15 (33)
        • ►  Aug 14 (24)
        • ►  Aug 13 (28)
        • ►  Aug 12 (28)
        • ►  Aug 11 (28)
        • ►  Aug 10 (59)
        • ►  Aug 09 (33)
        • ►  Aug 08 (39)
        • ►  Aug 07 (23)
        • ►  Aug 06 (36)
        • ►  Aug 05 (23)
        • ►  Aug 04 (25)
        • ►  Aug 03 (17)
        • ►  Aug 02 (26)
        • ►  Aug 01 (51)
      • ▼  July (890)
        • ►  Jul 31 (27)
        • ►  Jul 30 (31)
        • ►  Jul 29 (29)
        • ►  Jul 28 (40)
        • ►  Jul 27 (32)
        • ►  Jul 26 (16)
        • ►  Jul 25 (5)
        • ▼  Jul 24 (45)
          • How to Lose Belly Fat at Home
          • How Much Weight Can I Lose in a Month on Weight Wa...
          • Jenny Craig Vs. Weight Watchers
          • Amylase resistant starch
          • Wood preservatives
          • Ethylene response factor BnERF2-like (ERF2.4) from...
          • Effects of high temperature during grain filling o...
          • Socioeconomic development and wood consumption
          • Effects of sika deer browsing on the arthropod com...
          • June 2015, Volume 20, Issue 3, pp 321-327 First on...
          • Distribution pattern of coniferous seedlings after...
          • Projection of the probability of local extinction ...
          • The spatial distributions of understory trees in r...
          • Response of sap flow to flooding in plantations of...
          • Use of spatial pattern analysis to assess forest c...
          • Feasibility Study of Ethanol Production from Food ...
          • Fluctuations in Natural Populations of the Leaf mi...
          • Effect of Different Vegetable Oils (Red Palm Olein...
          • Calcium Chloride & the Heart
          • The Best Foods to Eat to Lose Stomach Weight
          • Growth and Yield of Solanum Tuberosum at Medium Pl...
          • Effect of Shading During Grain Filling on the Phys...
          • Slight shading after anthesis increases photosynth...
          • Nacre-like calcium carbonate controlled by ionic l...
          • Epidermal focusing of light and modelling of refle...
          • Shiitake (Lentinula edodes) cultivation in sawdust...
          • Zn2+, a key factor of colony morphogenesis of Tric...
          • Production and mechanical performance of scrimber ...
          • Effect of density on the hygroscopicity and surfac...
          • Distribution of boron in wood treated with aqueous...
          • SOIL CONTAMINATION
          • PESTICIDE DRIFT
          • ENCLOSURE
          • Turmeric, Lemon & Honey
          • How to Use Turmeric to Lighten Skin
          • Ground Turmeric Benefits
          • What Are the Benefits of Competitive Sports for Yo...
          • Natural Ways to Raise Endorphins
          • How to Stimulate the Production of Endorphins & Do...
          • Comparative study of radio-frequency and microwave...
          • Derivation of buckling design curves via FE modell...
          • Survey of selected adhesive bonding properties of ...
          • What Are the Benefits of the Migun Massage Bed?
          • Drinking Decaf Green Tea While Pregnant
          • Does Sweetened Green Tea Burn Fat?
        • ►  Jul 23 (16)
        • ►  Jul 22 (42)
        • ►  Jul 21 (11)
        • ►  Jul 20 (41)
        • ►  Jul 19 (31)
        • ►  Jul 18 (35)
        • ►  Jul 17 (41)
        • ►  Jul 16 (21)
        • ►  Jul 15 (23)
        • ►  Jul 14 (38)
        • ►  Jul 13 (49)
        • ►  Jul 12 (42)
        • ►  Jul 11 (25)
        • ►  Jul 10 (48)
        • ►  Jul 09 (33)
        • ►  Jul 08 (38)
        • ►  Jul 07 (19)
        • ►  Jul 06 (10)
        • ►  Jul 05 (14)
        • ►  Jul 04 (13)
        • ►  Jul 03 (20)
        • ►  Jul 02 (26)
        • ►  Jul 01 (29)
      • ►  June (1003)
        • ►  Jun 30 (29)
        • ►  Jun 29 (43)
        • ►  Jun 28 (27)
        • ►  Jun 27 (33)
        • ►  Jun 26 (49)
        • ►  Jun 25 (30)
        • ►  Jun 24 (32)
        • ►  Jun 23 (42)
        • ►  Jun 22 (38)
        • ►  Jun 21 (20)
        • ►  Jun 20 (30)
        • ►  Jun 19 (37)
        • ►  Jun 18 (15)
        • ►  Jun 17 (12)
        • ►  Jun 16 (52)
        • ►  Jun 15 (59)
        • ►  Jun 14 (49)
        • ►  Jun 13 (38)
        • ►  Jun 12 (39)
        • ►  Jun 11 (44)
        • ►  Jun 10 (22)
        • ►  Jun 09 (34)
        • ►  Jun 08 (39)
        • ►  Jun 07 (28)
        • ►  Jun 06 (38)
        • ►  Jun 05 (19)
        • ►  Jun 04 (20)
        • ►  Jun 03 (27)
        • ►  Jun 02 (27)
        • ►  Jun 01 (31)
      • ►  May (648)
        • ►  May 31 (32)
        • ►  May 30 (48)
        • ►  May 29 (46)
        • ►  May 28 (43)
        • ►  May 27 (19)
        • ►  May 26 (37)
        • ►  May 25 (29)
        • ►  May 24 (22)
        • ►  May 23 (23)
        • ►  May 22 (18)
        • ►  May 21 (18)
        • ►  May 20 (22)
        • ►  May 19 (28)
        • ►  May 18 (12)
        • ►  May 17 (24)
        • ►  May 16 (9)
        • ►  May 15 (18)
        • ►  May 14 (13)
        • ►  May 13 (16)
        • ►  May 12 (6)
        • ►  May 11 (15)
        • ►  May 10 (15)
        • ►  May 09 (25)
        • ►  May 08 (14)
        • ►  May 07 (15)
        • ►  May 06 (10)
        • ►  May 04 (21)
        • ►  May 03 (22)
        • ►  May 02 (9)
        • ►  May 01 (19)
      • ►  April (490)
        • ►  Apr 30 (7)
        • ►  Apr 29 (21)
        • ►  Apr 28 (19)
        • ►  Apr 27 (15)
        • ►  Apr 26 (12)
        • ►  Apr 25 (19)
        • ►  Apr 24 (13)
        • ►  Apr 23 (24)
        • ►  Apr 22 (24)
        • ►  Apr 21 (22)
        • ►  Apr 20 (19)
        • ►  Apr 19 (46)
        • ►  Apr 18 (24)
        • ►  Apr 17 (15)
        • ►  Apr 16 (19)
        • ►  Apr 15 (8)
        • ►  Apr 14 (19)
        • ►  Apr 13 (22)
        • ►  Apr 12 (18)
        • ►  Apr 11 (11)
        • ►  Apr 10 (13)
        • ►  Apr 09 (12)
        • ►  Apr 08 (12)
        • ►  Apr 07 (15)
        • ►  Apr 06 (16)
        • ►  Apr 05 (10)
        • ►  Apr 04 (8)
        • ►  Apr 03 (15)
        • ►  Apr 01 (12)
      • ►  March (445)
        • ►  Mar 31 (7)
        • ►  Mar 30 (10)
        • ►  Mar 29 (17)
        • ►  Mar 28 (15)
        • ►  Mar 27 (8)
        • ►  Mar 26 (11)
        • ►  Mar 25 (10)
        • ►  Mar 24 (9)
        • ►  Mar 23 (13)
        • ►  Mar 22 (9)
        • ►  Mar 21 (13)
        • ►  Mar 20 (9)
        • ►  Mar 19 (15)
        • ►  Mar 18 (14)
        • ►  Mar 17 (11)
        • ►  Mar 16 (15)
        • ►  Mar 15 (23)
        • ►  Mar 14 (26)
        • ►  Mar 13 (20)
        • ►  Mar 12 (14)
        • ►  Mar 11 (18)
        • ►  Mar 10 (27)
        • ►  Mar 09 (18)
        • ►  Mar 08 (25)
        • ►  Mar 07 (11)
        • ►  Mar 06 (15)
        • ►  Mar 05 (18)
        • ►  Mar 04 (9)
        • ►  Mar 03 (14)
        • ►  Mar 02 (7)
        • ►  Mar 01 (14)
      • ►  February (258)
        • ►  Feb 29 (22)
        • ►  Feb 28 (14)
        • ►  Feb 27 (12)
        • ►  Feb 26 (4)
        • ►  Feb 25 (17)
        • ►  Feb 24 (16)
        • ►  Feb 23 (16)
        • ►  Feb 22 (8)
        • ►  Feb 21 (23)
        • ►  Feb 20 (6)
        • ►  Feb 19 (5)
        • ►  Feb 18 (3)
        • ►  Feb 17 (9)
        • ►  Feb 16 (17)
        • ►  Feb 15 (20)
        • ►  Feb 14 (10)
        • ►  Feb 13 (17)
        • ►  Feb 11 (3)
        • ►  Feb 10 (1)
        • ►  Feb 08 (2)
        • ►  Feb 07 (5)
        • ►  Feb 05 (2)
        • ►  Feb 04 (10)
        • ►  Feb 03 (7)
        • ►  Feb 02 (1)
        • ►  Feb 01 (8)
      • ►  January (8)
        • ►  Jan 30 (4)
        • ►  Jan 10 (4)
    • ►  2013 (23)
      • ►  February (18)
        • ►  Feb 07 (1)
        • ►  Feb 06 (2)
        • ►  Feb 05 (8)
        • ►  Feb 04 (5)
        • ►  Feb 02 (1)
        • ►  Feb 01 (1)
      • ►  January (5)
        • ►  Jan 31 (4)
        • ►  Jan 30 (1)

    Report Abuse

    Follower

    Translate

    Total Pageviews

    nuffnang ads

    Nuffnang Ads

    nuffnang ads

    Nuffnang Ads

    Picture Window theme. Theme images by sndrk. Powered by Blogger.